HELP     Sign In
Search

Relevance to Autism

Rare inherited loss-of-function variants in the ZNF626 gene were observed in ASD probands from the Simons Simplex Collection in Krumm et al., 2015. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of 536 Chinese ASD probands and 1457 Chinese controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, in Guo et al., 2017 identified ZNF626 as an ASD candidate gene with a PTADA of 0.000352.

Molecular Function

May be involved in transcriptional regulation.

External Links

        

References

Type
Title
Type of Disorder
Associated Disorders
Author, Year
Primary
Excess of rare, inherited truncating mutations in autism.
ASD
Recent Recommendation
Targeted sequencing and functional analysis reveal brain-size-related genes and their networks in autism spectrum disorders.

Rare

Variant ID
Variant Type
Allele Change
Residue Change
Inheritance Pattern
Inheritance Association
Family Type
Author, Year
 GEN944R001 
 stop_gained 
 c.1513G>T 
 p.Glu505Ter 
 Familial 
  
 Simplex 
 GEN944R002 
 stop_gained 
 T>A 
 p.Lys388Ter 
 Familial 
  
 Simplex 
 GEN944R003 
 frameshift_variant 
 TTC>T 
 -249 
 Familial 
  
 Simplex 
 GEN944R004 
 frameshift_variant 
 TTC>T 
 -249 
 Familial 
  
 Simplex 
 GEN944R005 
 frameshift_variant 
 TTC>T 
 -249 
 Familial 
  
 Simplex 
 GEN944R006 
 frameshift_variant 
 TTC>T 
 -249 
 Familial 
  
 Simplex 
 GEN944R007 
 frameshift_variant 
 TTC>T 
 -249 
 Familial 
  
 Simplex 
 GEN944R008 
 frameshift_variant 
 TTC>T 
 -249 
 Familial 
  
 Simplex 
 GEN944R009 
 stop_gained 
 c.679A>T 
 p.Lys227Ter 
 Familial 
  
 Simplex 
 GEN944R010 
 frameshift_variant 
 CT>C 
 -115 
 Familial 
  
 Simplex 
 GEN944R011 
 frameshift_variant 
 G>GGACT 
 -88S? 
 Familial 
  
 Simplex 
 GEN944R012 
 stop_gained 
 c.1513G>T 
 p.Glu505Ter 
 Familial 
  
 Simplex 
 GEN944R013 
 stop_gained 
 c.1513G>T 
 p.Glu505Ter 
 Familial 
  
 Simplex 
 GEN944R014 
 frameshift_variant 
 ATTCTCTCATGTGTAGTAAGG>A 
 -495 
 Familial 
  
 Simplex 
 GEN944R015 
 frameshift_variant 
 TGCCACATTCTTCACATTTGTAGGGTCTCTCTCCAGTATGAATTTTCTTATGTGTAGTAAGGTTAGAGGAGCACTTAAAAGCTTTGCCACATTCTTCACA 
 -444 
 Familial 
  
 Simplex 
 GEN944R016 
 stop_gained 
 T>A 
 p.Lys388Ter 
 Familial 
  
 Simplex 
 GEN944R017 
 stop_gained 
 c.1162A>T 
 p.Lys388Ter 
 Familial 
  
 Simplex 
 GEN944R018 
 stop_gained 
 c.1162A>T 
 p.Lys388Ter 
 Familial 
  
 Simplex 
 GEN944R019 
 stop_gained 
 c.1162A>T 
 p.Lys388Ter 
 Familial 
  
 Simplex 
 GEN944R020 
 frameshift_variant 
 T>TA 
 -298? 
 Familial 
  
 Simplex 
 GEN944R021 
 frameshift_variant 
 T>TAG 
 -298? 
 Familial 
  
 Simplex 
 GEN944R022 
 frameshift_variant 
 TTC>T 
 -249 
 Familial 
  
 Simplex 
 GEN944R023 
 frameshift_variant 
 A>AT 
 -233? 
 Familial 
  
 Simplex 
 GEN944R024 
 frameshift_variant 
 G>GT 
 -169? 
 Familial 
  
 Simplex 
 GEN944R025 
 frameshift_variant 
 G>GGACT 
 -88S? 
 Familial 
  
 Simplex 
 GEN944R026 
 stop_lost 
 c.226+286T>C 
  
 Familial 
  
 Simplex 

Common

No Common Variants Available
Chromosome
CNV Locus
CNV Type
# of studies
Animal Model
19
Deletion-Duplication
 25
 
19
Duplication
 1
 
19
Duplication
 1
 
19
Duplication
 1
 
19
Duplication
 1
 
19
Duplication
 1
 

No Animal Model Data Available

No PIN Data Available
HELP
Copyright © 2017 MindSpec, Inc.