HELP     Sign In
Search

Relevance to Autism

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders (Smalley et al., 1998). Schaaf et al., 2011 and Kelleher et al., 2012 identified a number of TSC2 missense variants in ASD probands that were not observed in control populations. Rare de novo and inherited missense variants in TSC2 have been identified in ASD probands from the Simons Simplex Collection (ORoak et al., 2012; Bahl et al., 2013; Iossifov et al., 2014), as well as in ASD probands from the Autism Clinical and Genetic Resources in China (ACGC) cohort (Wang et al., 2016). Targeted gene panel screening of a clinical population of 100 children with ASD from the Connecticut Childrens Medical Center Autism Neurogenetics Program in Kalsner et al., 2016 identified 18 rare TSC2 variants in ASD cases (18.0%) compared to 9.8% in the ExAC database (P = 0.0062); the statistical enrichment of rare TSC2 variants in ASD cases remained significant after multiple comparisons correction. Addtional de novo loss-of-function variants and potentially damaging missense variants in the TSC2 gene were reported in ASD probands from the Autism Sequencing Consortium, the MSSNG cohort, and the SPARK cohort in Zhou et al., 2022; a two-stage analysis of rare de novo and inherited coding variants in 42,607 ASD cases, including 35,130 new cases from the SPARK cohort, in this report identified TSC2 as a gene reaching exome-wide significance (P < 2.5E-06).

Molecular Function

The product of this gene is believed to be a tumor suppressor and is able to stimulate specific GTPases.

External Links

        

References

Type
Title
Type of Disorder
Associated Disorders
Author, Year
Primary
Autism and tuberous sclerosis.
Tuberous sclerosis-2
ASD
Positive Association
Association of INPP1, PIK3CG, and TSC2 gene variants with autistic disorder: implications for phosphatidylinositol signalling in autism.
ASD
Negative Association
Lack of association of rare functional variants in TSC1/TSC2 genes with autism spectrum disorder.
ASD
Support
Autism spectrum disorder and comorbid neurodevelopmental disorders (ASD-NDDs): Clinical and genetic profile of a pediatric cohort
ASD
Epilepsy/seizures
Support
Somatic Mutations in TSC1 and TSC2 Cause Focal Cortical Dysplasia.
Focal cortical dysplasia
Support
Genomic insights from a deeply phenotyped highly consanguineous neurodevelopmental disorders cohort
DD
ASD, epilepsy/seizures
Support
Genetic and Phenotype Analysis of a Chinese Cohort of Infants and Children With Epilepsy
Epilepsy/seizures
ID
Support
Rare genetic susceptibility variants assessment in autism spectrum disorder: detection rate and practical use.
ASD
Support
High-throughput sequencing of mGluR signaling pathway genes reveals enrichment of rare variants in autism.
Non-syndromic ASD
Support
Whole Exome Sequencing as a First-Line Molecular Genetic Test in Developmental and Epileptic Encephalopathies
ID, epilepsy/seizures
Support
mTOR-related synaptic pathology causes autism spectrum disorder-associated functional hyperconnectivity
ASD
Support
Targeted sequencing identifies 91 neurodevelopmental-disorder risk genes with autism and developmental-disability biases.
ASD
Support
Genetic Diagnostic Yield in Autism Spectrum Disorder (ASD) and Epilepsy Phenotypes in Children with Genetically Defined ASD
ASD, Tuberous sclerosis complex
Epilepsy/seizures
Support
Drosophila functional screening of de novo variants in autism uncovers damaging variants and facilitates discovery of rare neurodevelopmental diseases
ASD
Support
Autism risk in offspring can be assessed through quantification of male sperm mosaicism.
ASD
Support
Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations.
ASD
Support
Clinical Utility of Proband Only Clinical Exome Sequencing in Neurodevelopmental Disorders
DD, epilepsy/seizures
Support
Microglial ASD-related genes are involved in oligodendrocyte differentiation
Support
De novo genic mutations among a Chinese autism spectrum disorder cohort.
ASD
Support
Hyperactive mTORC1 disrupts habenula function and light preference in zebrafish model of Tuberous sclerosis complex
Tuberous sclerosis 2, ASD
Support
Genetic care in geographically isolated small island communities: 8 years of experience in the Dutch Caribbean
Epilepsy/seizures
Support
Inherited and De Novo Genetic Risk for Autism Impacts Shared Networks.
ASD
Support
Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.
ASD
Support
Tuberous sclerosis
Support
Tuberous sclerosis complex (TSC) inactivation increases neuronal network activity by enhancing Ca 2+ influx via L-type Ca 2+ channels
Tuberous sclerosis complex
Support
Everolimus improves neuropsychiatric symptoms in a patient with tuberous sclerosis carrying a novel TSC2 mutation.
Tuberous sclerosis-2
ASD, DD, epilepsy
Support
Astroglial calcium signaling and homeostasis in tuberous sclerosis complex
Tuberous sclerosis 2
Support
Cerebellar demyelination and neurodegeneration associated with mTORC1 hyperactivity may contribute to the developmental onset of autism-like neurobehavioral phenotype in a rat model
ASD
Support
Neurological Diseases With Autism Spectrum Disorder: Role of ASD Risk Genes.
ASD
Tuberous sclerosis complex, epilepsy/seizures
Support
Tuberous sclerosis complex, ASD
Support
Genome sequencing of 320 Chinese children with epilepsy: a clinical and molecular study
DD, epilepsy/seizures
Support
Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients.
Epilepsy/seizures
MCAs
Support
Validation of targeted next-generation sequencing panels in a cohort of Polish patients with epilepsy: assessing variable performance across clinical endophenotypes and uncovering novel genetic varian
Epilepsy/seizures
Support
Disruption of Amygdala Tsc2 in Adolescence Leads to Changed Prelimbic Cellular Activity and Generalized Fear Responses at Adulthood in Rats
Support
Targeted resequencing of 358 candidate genes for autism spectrum disorder in a Chinese cohort reveals diagnostic potential and genotype-phenotype c...
ASD
Support
Trio-whole exome sequencing reveals the importance of de novo variants in children with intellectual disability and developmental delay
DD, epilepsy/seizures
Support
Anxiety disorder
BPD, depressive disorder, epilepsy/seizures
Support
Next-Generation Sequencing in Korean Children With Autism Spectrum Disorder and Comorbid Epilepsy
ASD
Epilepsy/seizures, tuberous sclerosis
Support
Excess of rare, inherited truncating mutations in autism.
ASD
Support
Amelioration of the brain structural connectivity is accompanied with changes of gut microbiota in a tuberous sclerosis complex mouse model
Tuberous sclerosis complex
ASD
Support
Sex-Dependent Social and Repetitive Behavior and Neurochemical Profile in Mouse Model of Autism Spectrum Disorder
ASD
Support
Diagnostic exome sequencing of syndromic epilepsy patients in clinical practice.
Epilepsy/seizures
DD, specific learning disability
Support
The application of whole-exome sequencing in the early diagnosis of rare genetic diseases in children: a study from Southeastern China
ID, epilepsy/seizures
Support
Developmental effects of constitutive mTORC1 hyperactivity and environmental enrichment on structural synaptic plasticity and behaviour in a rat model of autism spectrum disorder
ASD
Support
Utility of clinical exome sequencing in a complex Emirati pediatric cohort
ASD, DD
Support
Performance comparison of bench-top next generation sequencers using microdroplet PCR-based enrichment for targeted sequencing in patients with aut...
ASD
ID, epilepsy
Support
Reanalysis of Trio Whole-Genome Sequencing Data Doubles the Yield in Autism Spectrum Disorder: De Novo Variants Present in Half
ASD
ID
Highly Cited
Interaction between hamartin and tuberin, the TSC1 and TSC2 gene products.
Highly Cited
Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling.
Recent Recommendation
Genetic testing including targeted gene panel in a diverse clinical population of children with autism spectrum disorder: Findings and implications.
ASD
Recent Recommendation
Regulation of neuronal morphology and function by the tumor suppressors Tsc1 and Tsc2.
Recent Recommendation
Low load for disruptive mutations in autism genes and their biased transmission.
ASD
Recent Recommendation
Neuroepileptic correlates of autistic symptomatology in tuberous sclerosis.
Recent Recommendation
Loss of mTOR-dependent macroautophagy causes autistic-like synaptic pruning deficits.
Recent Recommendation
Identification of regions critical for the integrity of the TSC1-TSC2-TBC1D7 complex.
Recent Recommendation
Integrating de novo and inherited variants in 42
ASD
Recent Recommendation
ARD1 stabilization of TSC2 suppresses tumorigenesis through the mTOR signaling pathway.
Recent Recommendation
Regionally specific TSC1 and TSC2 gene expression in tuberous sclerosis complex.
Recent Recommendation
Tuberous sclerosis complex proteins control axon formation.
Recent Recommendation
Purkinje cells derived from TSC patients display hypoexcitability and synaptic deficits associated with reduced FMRP levels and reversed by rapamycin.
Recent Recommendation
Reversal of learning deficits in a Tsc2 mouse model of tuberous sclerosis.
Variant ID
Variant Type
Allele Change
Residue Change
Inheritance Pattern
Inheritance Association
Family Type
Author, Year
 GEN256R001 
  
  
  
  
  
  
 GEN256R002 
 missense_variant 
 c.148A>G 
 p.Met50Val 
 Unknown 
  
 Simplex 
 GEN256R003 
 missense_variant 
 c.1378G>A 
 p.Ala460Thr 
 Unknown 
  
 Simplex 
 GEN256R004 
 missense_variant 
 c.1597A>C 
 p.Lys533Gln 
 Familial 
 Maternal 
 Simplex 
 GEN256R005 
 missense_variant 
 c.1609C>T 
 p.Arg537Cys 
 Unknown 
  
 Simplex 
 GEN256R006 
 missense_variant 
 c.1816A>G 
 p.Ile606Val 
 Unknown 
  
 Simplex 
 GEN256R007 
 missense_variant 
 c.2032G>A 
 p.Ala678Thr 
 Familial (1 case); unknown (1 case) 
 Maternal (1 case) 
 Simplex 
 GEN256R008 
 missense_variant 
 c.2712C>G 
 p.Phe904Leu 
 Unknown 
  
 Simplex 
 GEN256R009 
 missense_variant 
 c.2950G>C 
 p.Glu984Gln 
 Familial 
 Paternal 
 Simplex 
 GEN256R010 
 missense_variant 
 c.3293C>T 
 p.Pro1098Leu 
 Unknown 
  
 Simplex 
 GEN256R011 
 missense_variant 
 c.3422C>T 
 p.Ala1141Val 
 Familial 
 Paternal 
 Simplex 
 GEN256R012 
 missense_variant 
 c.4106G>A 
 p.Arg1369Gln 
 Unknown 
  
 Simplex 
 GEN256R013 
 missense_variant 
 c.4273G>A 
 p.Gly1425Arg 
 Unknown 
  
 Simplex 
 GEN256R014 
 missense_variant 
 c.5094C>A 
 p.Ser1698Arg 
 Familial 
 Maternal 
 Simplex 
 GEN256R015 
 inframe_deletion 
 c.3846_3854del 
 p.Ser1282_Gly1285delinsArg 
 De novo 
  
 Simplex 
 GEN256R016 
 missense_variant 
 c.4738C>T 
 p.Arg1580Trp 
 De novo 
  
 Simplex 
 GEN256R017 
 missense_variant 
 c.433G>A 
 p.Ala145Thr 
  
  
 Multiplex 
 GEN256R018 
 synonymous_variant 
 c.618C>T 
 p.Cys206= 
  
  
 Multiplex 
 GEN256R019 
 synonymous_variant 
 c.1143G>A 
 p.Arg381= 
  
  
 Multiplex 
 GEN256R020 
 missense_variant 
 c.1292C>T 
 p.Ala431Val 
  
  
 Multiplex 
 GEN256R021 
 intron_variant 
 c.1839+6G>A 
  
  
  
 Multiplex 
 GEN256R022 
 missense_variant 
 c.1912G>A 
 p.Val638Met 
  
  
 Multiplex 
 GEN256R023 
 missense_variant 
 c.2155T>C 
 p.Tyr719His 
  
  
 Multiplex 
 GEN256R024 
 missense_variant 
 c.2621C>T 
 p.Pro874Leu 
  
  
 Multiplex 
 GEN256R025 
 synonymous_variant 
 c.3126G>T 
 p.Pro1042= 
  
  
 Multiplex 
 GEN256R026 
 missense_variant 
 c.3252C>G 
 p.Asp1084Glu 
  
  
 Multiplex 
 GEN256R027 
 missense_variant 
 c.3827C>T 
 p.Ser1276Phe 
  
  
 Multiplex 
 GEN256R028 
 missense_variant 
 c.3914C>T 
 p.Pro1305Leu 
  
  
 Multiplex 
 GEN256R029 
 missense_variant 
 c.3974G>A 
 p.Gly1325Asp 
  
  
 Multiplex 
 GEN256R030 
 missense_variant 
 c.4051G>A 
 p.Glu1351Lys 
  
  
 Multiplex 
 GEN256R031 
 missense_variant 
 c.4316G>A 
 p.Gly1439Asp 
  
  
 Multiplex 
 GEN256R032 
 synonymous_variant 
 c.4341C>T 
 p.Ser1447= 
  
  
 Multiplex 
 GEN256R033 
 missense_variant 
 c.4460C>G 
 p.Ser1487Cys 
  
  
 Multiplex 
 GEN256R034 
 synonymous_variant 
 c.5028G>A 
 p.Leu1676= 
  
  
 Multiplex 
 GEN256R035 
 intron_variant 
 c.5069-8C>T 
  
  
  
 Multiplex 
 GEN256R036 
 synonymous_variant 
 c.5175G>A 
 p.Val1725= 
  
  
 Multiplex 
 GEN256R037 
 3_prime_UTR_variant 
 c.*5G>A 
  
  
  
 Multiplex 
 GEN256R038 
 3_prime_UTR_variant 
 c.*26G>A 
  
  
  
 Multiplex 
 GEN256R039 
 missense_variant 
 c.190A>G 
 p.Ile64Val 
 Familial 
 Paternal 
 Simplex 
 GEN256R040 
 missense_variant 
 c.454C>G 
 p.His152Asp 
 Familial 
 Maternal 
 Simplex 
 GEN256R041 
 missense_variant 
 c.1597A>C 
 p.Lys533Gln 
 Familial 
 Maternal 
 Simplex 
 GEN256R042 
 missense_variant 
 c.2861A>G 
 p.Lys954Arg 
 Familial 
 Paternal 
 Simplex 
 GEN256R043 
 missense_variant 
 c.2950G>C 
 p.Glu984Gln 
 Familial 
 Paternal 
 Simplex 
 GEN256R044 
 missense_variant 
 c.4285G>T 
 p.Ala1429Ser 
 Familial 
  
 Simplex 
 GEN256R045 
 missense_variant 
 c.2032G>A 
 p.Ala678Thr 
 Unknown 
  
 Unknown 
 GEN256R046 
 missense_variant 
 c.1643G>T 
 p.Arg548Met 
 De novo 
  
 Simplex 
 GEN256R047 
 frameshift_variant 
 c.3202del 
 p.Thr1068LeufsTer2 
 Unknown 
  
 Unknown 
 GEN256R048 
 frameshift_variant 
 c.538_539del 
 p.Leu180GlyfsTer8 
 Familial 
  
 Multi-generational 
 GEN256R049 
 missense_variant 
 c.2377G>A 
 p.Glu793Lys 
 De novo 
  
  
 GEN256R050 
 missense_variant 
 c.3100G>A 
 p.Val1034Ile 
 Familial 
 Maternal 
  
 GEN256R051 
 missense_variant 
 c.1939G>A 
 p.Asp647Asn 
 Familial 
 Paternal 
  
 GEN256R052 
 stop_gained 
 c.5323A>T 
 p.Lys1775Ter 
 De novo 
  
  
 GEN256R053 
 missense_variant 
 c.4639G>A 
 p.Val1547Ile 
  
  
  
 GEN256R054 
 missense_variant 
 c.1946T>C 
 p.Met649Thr 
 Familial 
 Maternal 
  
 GEN256R055 
 missense_variant 
 c.583A>G 
 p.Ile195Val 
 De novo 
  
  
 GEN256R056 
 missense_variant 
 c.4285G>T 
 p.Ala1429Ser 
 Familial 
 Maternal 
  
 GEN256R057 
 missense_variant 
 c.2153G>C 
 p.Arg718Pro 
 Familial 
 Paternal 
  
 GEN256R058 
 missense_variant 
 c.5359G>A 
 p.Gly1787Ser 
 Unknown 
  
  
 GEN256R059 
 missense_variant 
 c.5359G>A 
 p.Gly1787Ser 
 Familial 
 Maternal 
  
 GEN256R060 
 missense_variant 
 c.5065A>G 
 p.Lys1689Glu 
 Unknown 
  
  
 GEN256R061 
 missense_variant 
 c.1747G>A 
 p.Ala583Thr 
 Familial 
 Maternal 
  
 GEN256R062 
 missense_variant 
 c.2035G>A 
 p.Val679Met 
 Unknown 
  
  
 GEN256R063 
 missense_variant 
 c.5413G>A 
 p.Glu1805Lys 
 Familial 
 Paternal 
  
 GEN256R064 
 missense_variant 
 c.1070C>T 
 p.Ala357Val 
 Familial 
 Paternal 
  
 GEN256R065 
 missense_variant 
 c.1318G>A 
 p.Gly440Ser 
 Unknown 
  
  
 GEN256R066 
 inframe_deletion 
 CCTT>C 
  
 Familial 
 Maternal 
  
 GEN256R067 
 inframe_insertion 
 C>CCAGCGGGTAGGGAATATGGGGCTCCCT 
  
 Familial 
 Paternal 
  
 GEN256R068 
 missense_variant 
 c.1747G>A 
 p.Ala583Thr 
 Unknown 
  
  
 GEN256R069 
 inframe_deletion 
 CCTT>C 
  
 Unknown 
  
  
 GEN256R070 
 missense_variant 
 c.1865G>A 
 p.Arg622Gln 
 Familial 
 Paternal 
  
 GEN256R071 
 missense_variant 
 c.1747G>A 
 p.Ala583Thr 
 Unknown 
  
  
 GEN256R072 
 missense_variant 
 c.886G>A 
 p.Val296Met 
 Familial 
 Paternal 
  
 GEN256R073 
 splice_site_variant 
 c.4662+1G>A 
  
 De novo 
  
  
 GEN256R074 
 frameshift_variant 
 c.4538_4548del 
 p.Glu1513AlafsTer7 
 De novo 
  
  
 GEN256R075 
 missense_variant 
 c.919C>G 
 p.His307Asp 
 Familial 
 Maternal 
  
 GEN256R076 
 missense_variant 
 c.1864C>T 
 p.Arg622Trp 
 Familial 
 Paternal 
  
 GEN256R077 
 missense_variant 
 c.2636C>T 
 p.Ser879Phe 
 De novo 
  
 Multiplex (monozygotic twins) 
 GEN256R078 
 splice_site_variant 
 c.600-1G>A 
  
 De novo 
  
 Simplex 
 GEN256R079 
 frameshift_variant 
 c.3023_3026del 
 p.Val1008AlafsTer7 
 De novo 
  
 Simplex 
 GEN256R080 
 missense_variant 
 c.1754G>A 
 p.Arg585His 
 Unknown 
  
 Simplex 
 GEN256R081 
 inframe_deletion 
 c.4744_4746del 
 p.Ile1582del 
 Unknown 
  
  
 GEN256R082 
 intron_variant 
 c.2838-122G>A 
  
 Unknown 
  
  
 GEN256R083 
 splice_region_variant 
 c.849-3T>G 
  
 Unknown 
  
  
 GEN256R084 
 splice_site_variant 
 c.1839+1G>T 
  
 Unknown 
  
  
 GEN256R085 
 stop_gained 
 c.2353C>T 
 p.Gln785Ter 
 Unknown 
  
  
 GEN256R086 
 splice_site_variant 
 c.2639+2T>C 
  
 Unknown 
  
  
 GEN256R087 
 splice_site_variant 
 c.3284+1G>A 
  
 Familial 
 Paternal 
  
 GEN256R088 
 frameshift_variant 
 c.4589dup 
 p.Val1531GlyfsTer35 
 Unknown 
  
  
 GEN256R089 
 splice_site_variant 
 c.599+1G>A 
  
 Unknown 
  
  
 GEN256R090 
 missense_variant 
 c.1864C>T 
 p.Arg622Trp 
 Familial 
 Paternal 
  
 GEN256R091 
 splice_site_variant 
 c.1443+1G>A 
  
 Unknown 
  
  
 GEN256R092 
 stop_gained 
 c.4183C>T 
 p.Gln1395Ter 
 Unknown 
  
  
 GEN256R093 
 frameshift_variant 
 c.5025_5032dup 
 p.Tyr1678CysfsTer151 
 De novo 
  
  
 GEN256R094 
 frameshift_variant 
 c.2182del 
 p.Cys728AlafsTer43 
 Unknown 
  
  
 GEN256R095 
 missense_variant 
 c.5126C>T 
 p.Pro1709Leu 
 Unknown 
  
  
 GEN256R096 
 missense_variant 
 c.632C>T 
 p.Ser211Phe 
 Unknown 
  
  
 GEN256R097 
 missense_variant 
 c.1168A>T 
 p.Thr390Ser 
 Unknown 
  
  
 GEN256R098 
 missense_variant 
 c.2636C>T 
 p.Ser879Phe 
 De novo 
  
  
 GEN256R099 
 inframe_deletion 
 c.5238_5255del 
 p.His1746_Arg1751del 
 De novo 
  
  
 GEN256R100 
 synonymous_variant 
 c.2586G>A 
 p.Ala862%3D 
 De novo 
  
 Simplex 
 GEN256R101 
 missense_variant 
 c.2044G>C 
 p.Gly682Arg 
 De novo 
  
 Simplex 
 GEN256R102 
 missense_variant 
 c.4470G>C 
 p.Glu1490Asp 
 De novo 
  
 Simplex 
 GEN256R103 
 splice_site_variant 
 c.1444-1G>A 
  
 De novo 
  
  
 GEN256R104 
 missense_variant 
 c.4537G>A 
 p.Glu1513Lys 
 De novo 
  
  
 GEN256R105 
 splice_site_variant 
 c.775-1G>C 
  
 De novo 
  
  
 GEN256R106 
 stop_gained 
 c.1957A>T 
 p.Arg653Ter 
 De novo 
  
  
 GEN256R107 
 frameshift_variant 
 c.2086_2087del 
 p.Cys696LeufsTer6 
 De novo 
  
  
 GEN256R108 
 missense_variant 
 c.2089T>G 
 p.Leu697Val 
 De novo 
  
  
 GEN256R109 
 frameshift_variant 
 c.2475del 
 p.Leu826TrpfsTer3 
 De novo 
  
  
 GEN256R110 
 missense_variant 
 c.2742G>C 
 p.Lys914Asn 
 De novo 
  
  
 GEN256R111 
 missense_variant 
 c.4856T>C 
 p.Phe1619Ser 
 De novo 
  
  
 GEN256R112 
 stop_gained 
 c.3412C>T 
 p.Arg1138Ter 
 Unknown 
  
  
 GEN256R113 
 frameshift_variant 
 c.2859dup 
 p.Lys954GlnfsTer6 
 Unknown 
  
  
 GEN256R114 
 intron_variant 
 c.2838-122G>A 
  
 Unknown 
  
 Simplex 
 GEN256R115 
 missense_variant 
 c.4672G>A 
 p.Glu1558Lys 
 Unknown 
  
  
 GEN256R116 
 missense_variant 
 c.4678G>A 
 p.Ala1560Thr 
 De novo 
  
  
 GEN256R117 
 missense_variant 
 c.2070C>G 
 p.Phe690Leu 
 Familial 
 Maternal 
 Simplex 
 GEN256R118 
 missense_variant 
 c.880G>A 
 p.Gly294Arg 
 De novo 
  
 Simplex 
 GEN256R119 
 splice_site_variant 
 c.5068+2T>C 
  
 Familial 
 Paternal 
 Multiplex 
 GEN256R120 
 copy_number_loss 
  
  
 Familial 
 Maternal 
  
 GEN256R121 
 frameshift_variant 
 c.1572dupC 
 p.Asn525fs 
 Unknown 
  
  
 GEN256R122 
 inframe_deletion 
 c.4912_4914del 
 p.Lys1638del 
 De novo 
  
 Simplex 
 GEN256R123 
 missense_variant 
 c.2133G>T 
 p.Glu711Asp 
 Unknown 
  
  
 GEN256R124 
 missense_variant 
 c.2510T>C 
 p.Leu837Pro 
 Unknown 
  
  
 GEN256R125 
 missense_variant 
 c.5172G>T 
 p.Gln1724His 
 Unknown 
  
  
 GEN256R126 
 frameshift_variant 
 c.5332_5387del 
 p.Ala1778HisfsTer89 
 Familial 
 Maternal 
 Multi-generational 
Chromosome
CNV Locus
CNV Type
# of studies
Animal Model
16
Deletion-Duplication
 71
 
16
Duplication
 2
 
16
Duplication
 3
 
16
Deletion-Duplication
 3
 
16
Deletion
 5
 

Model Summary

To provide an alternative model for Tuberous Sclerosis (TSC).

References

Type
Title
Author, Year
Primary
Tsc2() mice develop tumors in multiple sites that express gelsolin and are influenced by genetic background.
Additional
Increased levels of anxiety-related behaviors in a Tsc2 dominant negative transgenic mouse model of tuberous sclerosis.
Additional
Tsc2 gene inactivation causes a more severe epilepsy phenotype than Tsc1 inactivation in a mouse model of tuberous sclerosis complex.
Additional
Loss of Tsc2 in Purkinje cells is associated with autistic-like behavior in a mouse model of tuberous sclerosis complex.
Additional
Rapamycin reverses impaired social interaction in mouse models of tuberous sclerosis complex.
Loss of mTOR-dependent macroautophagy causes autistic-like synaptic pruning deficits.
Additional
Loss of mTOR-dependent macroautophagy causes autistic-like synaptic pruning deficits.
Additional
Increased Excitation-Inhibition Ratio Stabilizes Synapse and Circuit Excitability in Four Autism Mouse Models.
Additional
Postnatal immune activation causes social deficits in a mouse model of tuberous sclerosis: Role of microglia and clinical implications
Additional
mTOR-related synaptic pathology causes autism spectrum disorder-associated functional hyperconnectivity
Model Type: Genetic
Model Genotype: Homozygous
Mutation: Gene targeted replacement of exon 2 of Tsc2 gene with a neomycin resistance cassette.
Allele Type: Targeted (Knock Out)
Strain of Origin: Not Specified
Genetic Background: C57BL/6J or BALB/cJ
ES Cell Line: J1
Mutant ES Cell Line: Not Specified
Model Source: Not Specified
Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Mortality/lethality1
Increased
 General observations
 E12.5
General characteristics1
Abnormal
 General observations
 E8-e12.5
General characteristics1
Abnormal
 Histology
 E9-e11.5
Cardiovascular development and function1
Abnormal
 Histology
 E9-e11.5
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Motor phenotype, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior


Interactor Symbol Interactor Name Interactor Organism Entrez ID Uniprot ID Interaction Type Evidence Reference
4-Sep septin 4 5414 O43236 Y2H
Sakai Y , et al. 2011
ACTN2 actinin, alpha 2 88 P35609 Y2H
Sakai Y , et al. 2011
AKT1 v-akt murine thymoma viral oncogene homolog 1 207 P31749 Metabolic labeling with 32P; IP/WB
Dan HC , et al. 2002
AMPK AMP-activated protein kinase alpha subunit 43904 O18645 IP/WB; in vitro kinase assay
Kim M and Lee JH 2015
ANKRD35 ankyrin repeat domain 35 148741 Q8N283 Y2H
Sakai Y , et al. 2011
AR androgen receptor 367 P10275 ChIP-Seq; Capillary gel electrophoresis (CGE)
Rajan P , et al. 2011
ATPsynd ATP synthase subunit d, mitochondrial 42291 Q24251 Peptide microarray; IP/WB
Sun X , et al. 2014
axin1 axin 1 734298 Q9YGY0 IP/WB
Mak BC , et al. 2003
C19ORF75 SIGLEC family-like protein 1 284369 Q8N7X8 IP; LC-MS/MS
Huttlin EL , et al. 2015
C9ORF128 Protein FAM221B 392307 A6H8Z2 IP; LC-MS/MS
Huttlin EL , et al. 2015
CALM1 calmodulin 1 (phosphorylase kinase, delta) 801 P62158 Phage display; GST; Bimolecular fluorescence complementation assay
Noonan DJ , et al. 2002
CAV1 caveolin 1, caveolae protein, 22kDa 857 Q03135 IP/WB
Yamamoto Y , et al. 2002
CCNA2 cyclin A2 890 P20248 IP/WB
Catania MG , et al. 2001
CCNB1 cyclin B1 891 P14635 IP/WB
Catania MG , et al. 2001
CCND1 cyclin D1 595 P24385 IP/WB
Zacharek SJ , et al. 2005
CCND2 cyclin D2 894 P30279 IP/WB
Zacharek SJ , et al. 2005
CCND3 cyclin D3 896 P30281 IP/WB
Zacharek SJ , et al. 2005
CD79B B-cell antigen receptor complex-associated protein beta chain 974 P40259-2 IP; LC-MS/MS
Huttlin EL , et al. 2015
CD83 ITGB7 9308 Q01151 IP; LC-MS/MS
Huttlin EL , et al. 2015
CDK1 cyclin-dependent kinase 1 983 P06493 IP/WB
Catania MG , et al. 2001
CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1027 P46527 IP/WB
Rosner M and Hengstschlger M 2004
COL20A1 collagen, type XX, alpha 1 57642 Q9P218 IP; LC-MS/MS
Huttlin EL , et al. 2015
CRB3 crumbs homolog 3 (Drosophila) 92359 Q9BUF7 IP/WB; GST
Massey-Harroche D , et al. 2007
CUL4A cullin 4A 8451 Q13619 IP/WB
Hu J , et al. 2008
DAPK1 death-associated protein kinase 1 1612 P53355 Solid phase binding assay; IP/WB; Metabolic labeling with 32P; WB
Stevens C , et al. 2008
DDB1 damage-specific DNA binding protein 1, 127kDa 1642 Q16531 IP/WB
Hu J , et al. 2008
DDIT4 DNA-damage-inducible transcript 4 54541 Q9NX09 IP/WB
Vega-Rubin-de-Celis S , et al. 2010
EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1915 P68104 Y2H
Sakai Y , et al. 2011
ESR1 estrogen receptor 1 2099 P03372 IP/WB; GST
York B , et al. 2005
FBXW5 F-box and WD repeat domain containing 5 54661 Q969U6 Y2H; WB; in vitro ubiquitination assay; IP/WB
Hu J , et al. 2008
FMR1 fragile X mental retardation 1 14265 P35922 HITS-CLIP
Darnell JC , et al. 2011
Foxo1 forkhead box O1 56458 Q9R1E0 Y2H; IP/WB; GST
Cao Y , et al. 2006
GAPDH glyceraldehyde-3-phosphate dehydrogenase 2597 P04406 Y2H
Sakai Y , et al. 2011
GRB2 growth factor receptor-bound protein 2 2885 P62993 Y2H
Wang J , et al. 2008
GSK3B glycogen synthase kinase 3 beta 2932 P49841 IP/WB
Mak BC , et al. 2003
HERC1 hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 8925 Q15751 IP; MS; IP/WB
Chong-Kopera H , et al. 2006
HSPA1A heat shock 70kDa protein 1A 3303 P08107 IP; MS; IP/WB
Nellist M , et al. 2005
HTRA1 HtrA serine peptidase 1 5654 Q92743 Y2H; GST; IP/WB; in vitro proteolysis assay
Campioni M , et al. 2010
INADL InaD-like (Drosophila) 10207 Q8NI35 Y2H; GST; IP/WB
Massey-Harroche D , et al. 2007
LNX1 ligand of numb-protein X 1, E3 ubiquitin protein ligase 84708 Q8TBB1 Y2H; in vitro ubiquitination assay; IP/WB
Guo Z , et al. 2012
MAPK1 mitogen-activated protein kinase 1 5594 P28482 IP/WB; Metabolic labeling with 32P; IP; MS
Ma L , et al. 2005
MAPKAP1 mitogen-activated protein kinase associated protein 1 79109 Q9BPZ7 IP/WB
Huang J , et al. 2009
Mapkapk2 MAP kinase-activated protein kinase 2 17164 P49138 in vitro kinase assay
Li Y , et al. 2003
MDFI MyoD family inhibitor 4188 Q99750 Y2H
Corominas R , et al. 2014
MKRN1 makorin ring finger protein 1 23608 Q9UHC7 Y2H
Sakai Y , et al. 2011
MLST8 MTOR associated protein, LST8 homolog (S. cerevisiae) 64223 Q9BVC4 IP/WB
Huang J , et al. 2009
MRPL21 mitochondrial ribosomal protein L21 219927 Q7Z2W9 Y2H
Sakai Y , et al. 2011
MTOR mechanistic target of rapamycin (serine/threonine kinase) 2475 P42345 IP/WB
Huang J , et al. 2009
MYCBP2 MYC binding protein 2 23077 O75592 Y2H; GST; IP/WB
Murthy V , et al. 2003
NAA10 N(alpha)-acetyltransferase 10, NatA catalytic subunit 8260 A6NM98 GST; IP/WB; in vitro acetylation assay
Kuo HP , et al. 2010
NEK1 NIMA (never in mitosis gene a)-related kinase 1 4750 Q96PY6 Y2H
Surpili MJ , et al. 2003
NGFRAP1 nerve growth factor receptor (TNFRSF16) associated protein 1 27018 Q00994 IP/WB
Yasui S , et al. 2007
P4HA2 Prolyl 4-hydroxylase subunit alpha-2 8974 O15460-2 IP; LC-MS/MS
Huttlin EL , et al. 2015
P4HA3 prolyl 4-hydroxylase, alpha polypeptide III 283208 Q7Z4N8 IP; LC-MS/MS
Huttlin EL , et al. 2015
PHLDB1 pleckstrin homology-like domain, family B, member 1 23187 Q86UU1 Y2H
Sakai Y , et al. 2011
PICK1 protein interacting with PRKCA 1 9463 Q9NRD5 Y2H; GST
Sakai Y , et al. 2011
PIN1 peptidylprolyl cis/trans isomerase, NIMA-interacting 1 5300 Q13526 Y2H
Vinayagam A , et al. 2011
PIP4ks Phosphatidylinositol 5-phosphate 4-kinase type-2 gamma 117150 Q91XU3 IP/WB; in vitro kinase assay; LC-MS/MS
Mackey AM , et al. 2014
PKD1 polycystic kidney disease 1 (autosomal dominant) 5310 P98161 IP/WB
Dere R , et al. 2010
PLK1 polo-like kinase 1 5347 P53350 IP/WB
Astrinidis A , et al. 2005
PNKD Probable hydrolase PNKD 25953 Q8N490-2 IP; LC-MS/MS
Huttlin EL , et al. 2015
Ppp2ca protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform 19052 P63330 IP; MS; IP/WB
Lee WJ , et al. 2006
PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 5562 Q13131 EMSA; Metabolic labeling with 32P; in vitro kinase assay; 2-D phosphopeptide mapping
Inoki K , et al. 2003
PRKCSH protein kinase C substrate 80K-H 5589 P14314 IP; LC-MS/MS
Huttlin EL , et al. 2015
PTK2 PTK2 protein tyrosine kinase 2 5747 Q05397 IP/WB; GST; WB
Gan B , et al. 2006
RAB5A RAB5A, member RAS oncogene family 5868 P20339 IP/WB
Yamamoto Y , et al. 2002
RABEP1 rabaptin, RAB GTPase binding effector protein 1 9135 Q15276 Y2H
Xiao GH , et al. 1997
RALA v-ral simian leukemia viral oncogene homolog A (ras related) 5898 P11233 IP/WB
Castro AF , et al. 2003
RAP1A RAP1A, member of RAS oncogene family 5906 P62834 IP/WB
Yamamoto Y , et al. 2002
RB1CC1 RB1-inducible coiled-coil 1 9821 Q8TDY2 IP/WB
Gan B , et al. 2005
Rbfox1 RNA binding protein, fox-1 homolog (C. elegans) 1 268859 Q9JJ43 HITS-CLIP
Weyn-Vanhentenryck SM , et al. 2014
RHEB Ras homolog enriched in brain 6009 Q15382 GTP hydrolysis assay
Garami A , et al. 2003
RICTOR RPTOR independent companion of MTOR, complex 2 253260 Q6R327 IP/WB
Huang J , et al. 2009
ROCK1 Rho-associated, coiled-coil containing protein kinase 1 6093 Q13464 IP/WB; in vitro kinase assay
Park JH , et al. 2011
RP2 retinitis pigmentosa 2 (X-linked recessive) 6102 O75695 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL4 ribosomal protein L4 6124 P36578 Y2H
Sakai Y , et al. 2011
RPS6KA1 ribosomal protein S6 kinase, 90kDa, polypeptide 1 6195 Q15418 Metabolic labeling with 32P; in vitro kinase assay; IP/WB
Roux PP , et al. 2004
RPSA ribosomal protein SA 3921 P08865 Y2H
Sakai Y , et al. 2011
SERPINI1 serpin peptidase inhibitor, clade I (neuroserpin), member 1 5274 Q99574 Y2H; IP/WB
Sakai Y , et al. 2011
Sfn stratifin 55948 O70456 GST; IP/WB
Liu MY , et al. 2002
SIRT1 sirtuin 1 23411 A8K128 IP/WB
Ghosh HS , et al. 2010
SLC13A3 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 64849 Q8WWT9 Y2H
Sakai Y , et al. 2011
SMAD2 SMAD family member 2 4087 Q15796 IP/WB; GST
Birchenall-Roberts MC , et al. 2004
SMAD3 SMAD family member 3 4088 P84022 IP/WB; GST
Birchenall-Roberts MC , et al. 2004
SPERT spermatid associated 220082 Q8NA61 Y2H
Corominas R , et al. 2014
Spry2 sprouty homolog 2 (Drosophila) 306141 Q5HZA2 IP/WB
Scott CL , et al. 2010
SRCRB4D scavenger receptor cysteine rich domain containing, group B (4 domains) 136853 Q8WTU2 Y2H
Sakai Y , et al. 2011
TACC3 transforming, acidic coiled-coil containing protein 3 10460 Q9Y6A5 Y2H; GST; IP/WB
Gmez-Bald L , et al. 2010
TBC1D7 TBC1 domain family, member 7 51256 Q9P0N9 IP/WB; GST
Nakashima A , et al. 2007
TBC1D7 TBC1 domain family, member 7 51256 Q9P0N9 IP; LC-MS/MS
Huttlin EL , et al. 2015
TFAP4 transcription factor AP-4 (activating enhancer binding protein 4) 7023 Q01664 IP/WB; EMSA
Habib SL , et al. 2010
TK1 thymidine kinase 1, soluble 7083 P04183 Y2H
Vinayagam A , et al. 2011
TSC1 tuberous sclerosis 1 7248 Q92574 Y2H; IP/WB
van Slegtenhorst M , et al. 1998
TSC2 tuberous sclerosis 2 7249 P49815 IP/WB
Hoogeveen-Westerveld M , et al. 2012
UBC ubiquitin C 7316 P63279 IP/WB
Zheng L , et al. 2008
UBE3A ubiquitin protein ligase E3A 7337 Q05086 IP/WB; WB; GST
Zheng L , et al. 2008
US3 N/A 2703401 B9VQJ7 IP/WB; in vitro kinase assay
Chuluunbaatar U , et al. 2010
USPL1 ubiquitin specific peptidase like 1 10208 Q5W0Q7 Y2H
Sakai Y , et al. 2011
YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide 7529 P31946 GST
Nellist M , et al. 2002
YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 7531 P62258 GST
Nellist M , et al. 2002
YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide 7532 P61981 GST
Nellist M , et al. 2002
YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide 7533 Q04917 GST
Nellist M , et al. 2002
YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 10971 P27348 GST
Nellist M , et al. 2002
YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 7534 P63104 Y2H; GST; IP/WB
Nellist M , et al. 2002

COL20A1
HELP
Copyright © 2017 MindSpec, Inc.