HELP     Sign In
Search

Relevance to Autism

TAOK2 resides within the 16p11.2 microdeletion/microduplication region; deletions and duplications in this region are strongly associated with neurodevelopmental disorders, including ASD. A de novo loss-of-function (LoF) variant in the TAOK2 gene was identified in an ASD proband from a multiplex family in Yuen et al., 2017, while a second LoF variant in this gene was identified in another ASD proband in Lim et al., 2017. Taok2 heterozygous and knockout mice were found to display gene dosage-dependent impairments in cognition, anxiety, and social interaction, as well as dosage-dependent abnormalities in brain size and neural connectivity in multiple regions, deficits in cortical layering, dendrite and synapse formation, and reducted excitatory neurotransmission (Richter et al., 2018). Richter et al., 2018 also reported TAOK2 genetic variants identified by whole-genome and -exome sequencing of over 2600 families with ASD, including two de novo likely gene-disruptive variants [a missense variant (p.Ala135Pro) that was experimentally shown to display reduced kinase activity and alter dendrite growth and spine/synapse development, as well as a splice-site variant] in simplex families. Scharrenberg et al., 2022 showed that overexpression of TAOK2 with ASD-associated variants disrupted neuronal migration in an isoform-specific manner, neurons lacking Taok2 had unstable microtubules with reduced levels of acetylated tubulin and phosphorylated JNK1, mice lacking Taok2 developed gross cortical and cortex layering abnormalities, and acute Taok2 downregulation or Taok2 knockout delayed the migration of upper-layer cortical neurons in mice. Elkhateeb et al., 2025 recently reported 10 individuals with TAOK2 variants with associated phenotypes, including neurodevelopmental abnormalities (100%), macrocephaly (75%), autism spectrum disorder or autistic traits (75%), and obesity (70%).

Molecular Function

This gene encodes a serine/threonine protein kinase that is involved in many different processes, including, cell signaling, microtubule organization and stability, and apoptosis.

External Links

        

References

Type
Title
Type of Disorder
Associated Disorders
Author, Year
Primary
Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder
ASD
Support
Conserved Tao Kinase Activity Regulates Dendritic Arborization, Cytoskeletal Dynamics, and Sensory Function in Drosophila
ASD
Support
TAOK2 controls synaptic plasticity and anxiety via ERK and calcium signaling
Support
Rates, distribution and implications of postzygotic mosaic mutations in autism spectrum disorder.
ASD
Support
TAOK2 drives opposing cilia length deficits in 16p11.2 deletion and duplication carriers
Support
TAOK2 Kinase Mediates PSD95 Stability and Dendritic Spine Maturation through Septin7 Phosphorylation.
Support
Rare Variant Burden and Behavioral Phenotypes in Children with Autism in Slovakia
ASD
Support
Autism spectrum disorder susceptibility gene TAOK2 affects basal dendrite formation in the neocortex.
Support
Clinical Application of a Customized Gene Panel for Identifying Autism Spectrum Disorder-Associated Variants
ASD
DD, ID
Support
The autism susceptibility kinase, TAOK2, phosphorylates eEF2 and modulates translation
Support
TAOK2 is an ER-localized kinase that catalyzes the dynamic tethering of ER to microtubules
Recent Recommendation
Expanding the phenotype and genotype spectrum of TAOK1 neurodevelopmental disorder and delineating TAOK2 neurodevelopmental disorder
ASD, DD, ID
ADHD, epilepsy/seizures
Recent Recommendation
TAOK2 rescues autism-linked developmental deficits in a 16p11.2 microdeletion mouse model
ASD
Recent Recommendation
Altered TAOK2 activity causes autism-related neurodevelopmental and cognitive abnormalities through RhoA signaling.
ASD

Rare

Variant ID
Variant Type
Allele Change
Residue Change
Inheritance Pattern
Inheritance Association
Family Type
Author, Year
 GEN1006R001 
 frameshift_variant 
 TGGGCCCCCCTGCTGCCGCGGTGCCC>T 
 p.Pro1022Ter 
 De novo 
  
 Multiplex 
 GEN1006R002 
 stop_gained 
 c.1162G>T 
 p.Glu388Ter 
 De novo 
  
 Simplex 
 GEN1006R003 
 missense_variant 
 c.403G>C 
 p.Ala135Pro 
 De novo 
  
 Simplex 
 GEN1006R004 
 splice_site_variant 
 c.563+12_563+15del 
  
 De novo 
  
 Simplex 
 GEN1006R005 
 frameshift_variant 
 c.2749del 
 p.Leu917TrpfsTer3 
 Familial 
 Paternal 
 Multiplex 
 GEN1006R006 
 frameshift_variant 
 c.1811_1865del 
 p.Thr604SerfsTer45 
 Unknown 
  
 Simplex 
 GEN1006R007 
 stop_gained 
 c.1864C>T 
 p.Gln622Ter 
 Unknown 
  
 Simplex 
 GEN1006R008 
 missense_variant 
 c.1004C>T 
 p.Ala335Val 
 Familial 
 Paternal 
  
 GEN1006R009 
 missense_variant 
 c.1466G>A 
 p.Arg489Gln 
 Familial 
 Paternal 
 Multiplex 
 GEN1006R010 
 missense_variant 
 c.2233-96C>T 
  
 Familial 
 Paternal 
  
 GEN1006R011 
 missense_variant 
 c.2233-66G>A 
  
 Familial 
 Paternal 
  
 GEN1006R012 
 missense_variant 
 c.2474G>A 
 p.Cys825Tyr 
 Familial 
 Paternal 
  
 GEN1006R013 
 missense_variant 
 c.2512C>A 
 p.Leu838Ile 
 Familial 
 Paternal 
 Simplex 
 GEN1006R014 
 missense_variant 
 c.2987G>A 
 p.Arg996Gln 
 Familial 
 Maternal 
  
 GEN1006R015 
 missense_variant 
 c.3001C>G 
 p.Leu1001Val 
 Familial 
 Maternal 
 Multiplex 
 GEN1006R016 
 missense_variant 
 c.3046G>A 
 p.Val1016Ile 
 Familial 
 Maternal 
 Multiplex 
 GEN1006R017 
 missense_variant 
 c.3337C>T 
 p.Arg1113Cys 
 Familial 
 Maternal 
 Multiplex 
 GEN1006R018 
 missense_variant 
 c.3355C>A 
 p.Pro1119Thr 
 Familial 
 Maternal 
 Multiplex 
 GEN1006R019 
 missense_variant 
 c.2342A>G 
 p.Glu781Gly 
 Familial 
 Maternal 
  
 GEN1006R020 
 missense_variant 
  
  
 Unknown 
  
  
 GEN1006R021 
 missense_variant 
  
  
 Familial 
 Paternal 
  
 GEN1006R022 
 missense_variant 
 c.2609G>A 
 p.Trp870Ter 
 Familial 
 Maternal 
  
 GEN1006R023 
 missense_variant 
  
  
 Familial 
 Maternal 
  
 GEN1006R024 
 missense_variant 
  
  
 Unknown 
 Not maternal 
  
 GEN1006R025 
 missense_variant 
  
  
 Familial 
 Maternal 
  
 GEN1006R026 
 splice_site_variant 
 c.563+2T>C 
 p.? 
 Familial 
 Paternal 
 Simplex 
 GEN1006R027 
 synonymous_variant 
 c.1260G>A 
 p.Pro420= 
 De novo 
  
 Simplex 
 GEN1006R028 
 missense_variant 
 c.1496G>A 
 p.Arg499Gln 
 De novo 
  
 Simplex 
 GEN1006R029 
 frameshift_variant 
 c.2548delC 
 p.Arg850GlyfsTer46 
 De novo 
  
 Simplex 
 GEN1006R030 
 inframe_deletion 
 c.221_223del 
 p.Ile74del 
 Unknown 
  
 Simplex 
 GEN1006R031 
 frameshift_variant 
 c.2811dup 
 p.Cys938LeufsTer56 
 Unknown 
  
 Simplex 
 GEN1006R032 
 frameshift_variant 
 c.2551del 
 p.Val851CysfsTer45 
 Unknown 
  
 Simplex 
 GEN1006R033 
 stop_gained 
 c.1495C>T 
 p.Arg499Ter 
 Familial 
 Maternal 
 Extended multiplex 
 GEN1006R034 
 missense_variant 
 c.463G>A 
 p.Gly155Arg 
 Unknown 
  
 Simplex 
 GEN1006R035 
 missense_variant 
 c.2117C>T 
 p.Thr706Ile 
 Familial 
 Paternal 
  
 GEN1006R036 
 missense_variant 
 c.3697C>G 
 p.Pro1233Ala 
 Unknown 
  
  

Common

No Common Variants Available
Chromosome
CNV Locus
CNV Type
# of studies
Animal Model
16
Deletion-Duplication
 151
  construct
16
Duplication
 7
 
16
Deletion
 1
 
16
Deletion
 1
 
16
Duplication
 16
 

Model Summary

C57BL6/J Taok2 HT and HM KO mice exhibit abnormal brain morphology, increased brain volume, reduced volume of somatosensory cortex, reduced cerebral cortex, abnormal morphology and size of the corpus callosum, increased ambulation, decreased anxiety, decreased social approach, decreased basal dendrite arborization in the PFC, abnormal spine morphology, decreased synapse number, decreased excitatory neurotransmission, and decreased RhoA activation (Richter M, et al, Mol. Psych., 2018).

References

Type
Title
Author, Year
Primary
Altered TAOK2 activity causes autism-related neurodevelopmental and cognitive abnormalities through RhoA signaling.
Additional
TAOK2 rescues autism-linked developmental deficits in a 16p11.2 microdeletion mouse model

M_TAOK2_1_KO_HM

Model Type: Genetic
Model Genotype: Homozygous
Mutation: Taok2 homozygous knockout mice were generated through Cre mediated deletion of lox P sites within the first and seventh introns of the Taok2 gene. C57BL/6Jtyrc-2Jmice carry a recessive point mutation in the tyrosinase gene resulting in a white coat color, allowing the distinction of targeted cells that confer a black coat color. .
Allele Type: knockout
Strain of Origin: C57BL/6NTac
Genetic Background: C57BL/6 * C57BL/6NTac * SJL
ES Cell Line:
Mutant ES Cell Line: PRX-B6N; C57BL/6J^tyrc-2J-derived blastocysts
Model Source: MGI:5554941

M_TAOK2_2_KO_HT

Model Type: Genetic
Model Genotype: Heterozygous
Mutation: Taok2 heterozygous knockout mice were generated through Cre mediated deletion of lox P sites within the first and seventh introns of the Taok2 gene. C57BL/6Jtyrc-2Jmice carry a recessive point mutation in the tyrosinase gene resulting in a white coat color, allowing the distinction of targeted cells that confer a black coat color. .
Allele Type: knockout
Strain of Origin: C57BL/6NTac
Genetic Background: C57BL/6 * C57BL/6NTac * SJL
ES Cell Line:
Mutant ES Cell Line: PRX-B6N; C57BL/6J^tyrc-2J-derived blastocysts
Model Source: MGI:5554941

M_TAOK2_3_KO_HM

Model Type: Genetic
Model Genotype: Homozygous
Mutation: A loxP site was inserted upstream of exon 2. An FRT- and loxP-flanked neomycin resistance cassette was inserted downstream of exon 7. Flp-mediated recombination removed the selection cassette. Cre-mediated recombination removed exons 2 through 7.
Allele Type: Knockout
Strain of Origin: C57BL/6NTac
Genetic Background: C57BL6/J
ES Cell Line: PRX-B6N
Mutant ES Cell Line:
Model Source: Kapfhammer

M_TAOK2_4_KO_HT

Model Type: Genetic
Model Genotype: Heterozygous
Mutation: A loxP site was inserted upstream of exon 2. An FRT- and loxP-flanked neomycin resistance cassette was inserted downstream of exon 7. Flp-mediated recombination removed the selection cassette. Cre-mediated recombination removed exons 2 through 7.
Allele Type: Knockout
Strain of Origin: C57BL/6NTac
Genetic Background: C57BL6/J
ES Cell Line: PRX-B6N
Mutant ES Cell Line:
Model Source: Kapfhammer

M_TAOK2_5_KD

Model Type: Genetic
Model Genotype: Wildtype
Mutation: The Taok2 shRNA sequence was inserted into a pSilencer vector. A pSilencer vector containing a random sequence hairpin insert was used as a control for the shRNA. For acute Taok2 downregulation, mouse embryos were electroporated bilaterally in utero. The left hemisphere was electroporated at E15 with Taok2 shRNA and Venus plasmid, while the right hemisphere was electroporated with control shRNA together with mCherry plasmid.
Allele Type: Knockdown
Strain of Origin:
Genetic Background: C57BL6/J
ES Cell Line:
Mutant ES Cell Line:
Model Source:

M_TAOK2_6_KI_A135P

Model Type: Genetic
Model Genotype: Transgenic
Mutation: Human-derived mutations in TAOK2 were generated by site-directed mutagenesis. cDNA sequences of wildtype or mutated TAOK2 were re-cloned into a recombinant adeno-associated virus (rAAV)-vector under control of a chicken beta-actin promoter (pCAGIG). TAOK2 mutation construct together with a Venus-expressing plasmid were introduced into cortical progenitor cells by in utero electroporation at E15 to analyze upper-layer neurons.
Allele Type: ASD mutation
Strain of Origin:
Genetic Background: C57BL6/J
ES Cell Line:
Mutant ES Cell Line:
Model Source:

M_TAOK2_1_KO_HM

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity: ambulatory activity1
Increased
Description: Mutants travel greater distance on the open field test in comparison to controls.
Exp Paradigm: NA
 Open field test
 2-2.5 months
Brain size1
Decreased
Description: Mutants show smaller cortices than wt and taok2 het mice.
Exp Paradigm: Volumetric analysis was performed on whole non-fixed brain tissue.
 Magnetic resonance imaging (mri)
 4 weeks
Dendritic architecture: spine morphology1
Abnormal
Description: Mutants show an increase in the number of immature thin and stubby dendritic spines and a decrease in the number of mature mushroom spines compared to controls. mutants show decreased spine length and spine head width compared to controls.
Exp Paradigm: NA
 Golgi-cox staining
 3 weeks
Dendritic architecture: dendritic length1
Decreased
Description: Mutants show reduced basal dendrite length compared with wt neurons, with only minor reductions in the apical dendrites.
Exp Paradigm: NA
 Golgi-cox staining
 3 weeks
Brain size1
Increased
Description: Mutants show increase in total brain volume compared to controls. mutants show increased volume of the hindbrain, midbrain, hypothalamus, thalamus, cerebellum, and hippocampus compared to controls.
Exp Paradigm: Volumetric analysis was performed on whole fixed brain tissue.
 Magnetic resonance imaging (mri)
 2-2.5 months
Dendritic architecture: spine density1
Decreased
Description: Mutant neurons had significant changes in spine distribution and a reduction in the total number of basal dendrite spines per pfc neuron, compared to controls.
Exp Paradigm: NA
 Golgi-cox staining
 3 weeks
Cortical thickness1
Decreased
Description: Mutants show the thickness of the ctip2 layer (lower cortical layer) is not changed but the medial and dorsal region of the cortex shows decreases in the thickness of the cux-1-positive layer (upper cortical layer), together with an overall reduced cortex thickness in the dorsal-caudal region, in comparison with controls.
Exp Paradigm: Immunostained for the upper cortex marker cux-1 and the lower cortex marker ctip2 to analyze laminar organization including thickness and density of cortical layers.
 Immunostaining
 2-2.5 months
Synapse density1
Decreased
Description: Mutant brains show that the number of synapses formed onto the dendrite shaft instead of the postsynaptic spine heads was increased in prefrontal and somatosensory cortical neurons but not in the hippocampus, compared to controls.
Exp Paradigm: NA
 Electron microscopy
 3 weeks
Brain size1
Decreased
Description: Mutants show decreased volume of the somatosensory cortex compared to controls. mutants show decrease in volume of the corpus callosum, many cortical regions, the anterior commissure, and the olfactory bulbs compared to controls.
Exp Paradigm: Volumetric analysis was performed on whole fixed brain tissue.
 Magnetic resonance imaging (mri)
 2-2.5 months
Dendritic architecture: dendritic tree complexity1
Decreased
Description: Mutants show reduced basal dendrite complexity compared with wt neurons, with only minor reductions in the apical dendrites.
Exp Paradigm: NA
 Golgi-cox staining
 3 weeks
Cortical lamination1
Decreased
Description: Mutants show no change in the gross organization of cortical layers compared to controls. mutants show cux-1+ cells (upper cortical layer marker) clustered more in the superficial portion of the upper cortical plate, especially in the medial-caudal and dorsal cortex in comparison with controls, upon detailed examination.
Exp Paradigm: Immunostained for the upper cortex marker cux-1 and the lower cortex marker ctip2 to analyze laminar organization including thickness and density of cortical layers.
 Immunostaining
 2-2.5 months
Morphology and size of the corpus callosum1
Decreased
Description: Mutants show a regional delay of the development of neuronal tracks such as the corpus callosum compared to controls.
Exp Paradigm: NA
 Diffusion tensor imaging (dti)
 4 months
Anatomical projections and connectivity1
Increased
Description: Mutants show increased coherence within the beta band in comparison to controls, suggesting alterations in hippocampal and prefrontal cortex connectivity, and alterations in long-range functional connectivity, in comparison with controls.
Exp Paradigm: Simultaneous recordings of local field potential (lfp) and multiunit activity were performed from the prelimbic subdivision of the pfc and the ca1 area of the intermediate hippocampus.
 In vivo local field potential (lfp) recordings
 P8-10
Dendritic architecture: dendritic tree complexity1
Decreased
Description: Mutants show decreased dendritic arborization in neurons of the somatosensory cortex compared to controls.
Exp Paradigm: NA
 Golgi-cox staining
 3 weeks
Intrinsic bursting events or spikes1
Increased
Description: Mutant mice have increased power in discontinuous oscillations in theta (4-12hz), beta (12-30hz) and gamma (30-100hz) frequency ranges in pfc in comparison with controls. mutants show increase in the duration, amplitude, and power in theta (412 hz), beta (1230 hz), and gamma (30100 hz) frequency ranges in comparison with controls.
Exp Paradigm: NA
 In vivo local field potential (lfp) recordings
 P8-10
Miniature post synaptic current frequency: excitatory1
Decreased
Description: Mutants show reduction in the mean frequency of miniature excitatory postsynaptic currents (mepscs) in the pfc and somatosensory cortex, compared to controls.
Exp Paradigm: NA
 Whole-cell patch clamp
 3-4 weeks
Local field potential1
Decreased
Description: Mutants show decreased oscillatory events in the hippocampus in comparison to controls.
Exp Paradigm: Synchrony between oscillatory patterns of electrical activity in the prelimbic subdivision (pl) of the pfc and hc was tested. in vivo extracellular recordings of the lfp and multiple unit activity were conducted in postnatal day p8-10 mice because this is the period of maximal drive from hc to pl and is critical for prelimbic-hippocampal network maturation.
 In vivo local field potential (lfp) recordings
 P8-10
Social approach1
Decreased
Description: Mutant mice spent less time sniffing an unfamiliar sex-matched mouse instead of an unfamiliar object and compared with the wt littermates indicating reduced social drive.
Exp Paradigm: An empty beaker or a beaker container an unfamiliar male mouse was placed in a square space.
 Three-chamber social approach test
 2-2.5 months
Size/growth1
Decreased
Description: Mutants showed lower body weight compared to controls.
Exp Paradigm: NA
 Body weight measurement
 P7-10
Exploratory activity: habituation1
Decreased
Description: Mutants show enhanced locomotion only at time points 1530 min compared with wt mice, suggesting that the enhanced locomotion of taok2 ko mice was due to impaired short-term habituation.
Exp Paradigm: NA
 Open field test
 2-2.5 months
Anxiety1
Decreased
Description: Mutants travel a greater distance in the center of the open field in comparison to controls.
Exp Paradigm: NA
 Open field test
 2-2.5 months
Anxiety1
Decreased
Description: Mutants spend more time traveling in the open arms of the elevated plus maze in comparison with controls. mutants show no change in the number of entries or time spent in the closed arm or time spent in the center, in comparison to controls.
Exp Paradigm: NA
 Elevated plus maze test
 2-2.5 months
Object recognition memory1
Decreased
Description: Mutants show reduced preference for the displaced object when compared to controls.
Exp Paradigm: NA
 Object-place recognition test
 2-2.5 months
Spatial working memory1
Increased
Description: Mutants showed reduced mean minimal distance to the platform during the recall trial of the water maze test compared to controls.
Exp Paradigm: NA
 Morris water maze test
 2-2.5 months
Cued or contextual fear conditioning: memory of context: long term recall1
Decreased
Description: Mutant male mice spent less time immobile compared with wt male littermates, indicating oss of taok2 impairs consolidation or retention of emotional memories specifically in male mice.
Exp Paradigm: NA
 Fear conditioning test
 2-2.5 months
Spatial working memory1
Decreased
Description: Mutant mice performed less alternations than wt mice. reduced alteration do not seem to be caused by increased locomotion as the average transition time between arms did not differ from wt mice and percentage of alternations did not correlate with the average transition time at the individual level.
Exp Paradigm: NA
 Y-maze test
 2-2.5 months
Cued or contextual fear conditioning: memory of context1
Decreased
Description: Mutant males show increased immobility compared to controls.
Exp Paradigm: NA
 Fear conditioning test
 2-2.5 months
Spatial reference memory1
Increased
Description: Mutant mice searched more consistently for the platform at its former position than wt mice as indicated by the reduced mean minimal distance to platform and enhanced time spent at the platform position and platform crossings, compared to controls.
Exp Paradigm: NA
 Morris water maze test
 2-2.5 months
Enzyme activity1
Decreased
Description: Mutants show decreased active gtp-bound rhoa levels in cortical but not hippocampal brain lysates compared with wt. taok2 is minimally expressed in the hippocampus.
Exp Paradigm: NA
 Western blot
 2-2.5 months
Targeted expression1
Decreased
Description: Mutants show absence of native and phosphorylated taok2 expression in all regions of the brain compared to controls.
Exp Paradigm: NA
 Western blot
 3 weeks
Protein expression level evidence1
Increased
Description: Mutants show increased rhoa protein levels in cortical lysates compared to controls.
Exp Paradigm: NA
 Western blot
 2-2.5 months
Thigmotaxis1
 No change
 Morris water maze test
 2-2.5 months
Cued or contextual fear conditioning: memory of context1
 No change
 Fear conditioning test
 2-2.5 months
Cued or contextual fear conditioning: memory of context: long term recall1
 No change
 Fear conditioning test
 2-2.5 months
Spatial learning1
 No change
 Morris water maze test
 2-2.5 months
Swim distance1
 No change
 Morris water maze test
 2-2.5 months
General locomotor activity: ambulatory activity1
 No change
 Three-chamber social approach test
 2-2.5 months
General locomotor activity: ambulatory activity1
 No change
 Object-place recognition test
 2-2.5 months
Swimming ability1
 No change
 Morris water maze test
 2-2.5 months
Dendritic architecture: dendritic tree complexity1
 No change
 Golgi-cox staining
 3 weeks
Dendritic architecture: spine density1
 No change
 Golgi-cox staining
 3 weeks
Morphology and size of the corpus callosum1
 No change
 Diffusion tensor imaging (dti)
 1 week, 1 month, 4 months, 13 months
Neocortex morphology1
 No change
 Immunostaining
 2-2.5 months
Local field potential1
 No change
 In vivo local field potential (lfp) recordings
 P8-10
Miniature post synaptic current amplitude: excitatory1
 No change
 Whole-cell patch clamp
 3-4 weeks
Miniature post synaptic current amplitude: inhibitory1
 No change
 Whole-cell patch clamp
 3-4 weeks
Miniature post synaptic current frequency: inhibitory1
 No change
 Whole-cell patch clamp
 3-4 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Maternal behavior, Physiological parameters, Repetitive behavior, Seizure, Sensory

M_TAOK2_2_KO_HT

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Dendritic architecture: dendritic tree complexity1
Decreased
Description: Mutants show reduced basal dendrite complexity compared with wt neurons, with only minor reductions in the apical dendrites.
Exp Paradigm: NA
 Golgi-cox staining
 3 weeks
Brain size1
Increased
Description: Mutants show increase in total brain volume compared to controls. mutants show increased volume of the hindbrain, midbrain, hypothalamus, thalamus, cerebellum, and hippocampus compared to controls.
Exp Paradigm: NA
 Magnetic resonance imaging (mri)
 2-2.5 months
Morphology and size of the corpus callosum1
Decreased
Description: Mutants show a regional delay of the development of neuronal tracks such as the corpus callosum compared to controls.
Exp Paradigm: NA
 Diffusion tensor imaging (dti)
 4 months
Dendritic architecture: dendritic length1
Decreased
Description: Mutants show reduced basal dendrite length compared with wt neurons, with only minor reductions in the apical dendrites.
Exp Paradigm: NA
 Golgi-cox staining
 3 weeks
Brain size1
Decreased
Description: Mutants hsow decreased volume of the somatosensory cortex compared to controls. mutants show decrease in volume of the corpus callosum, many cortical regions, the anterior commissure, and the olfactory bulbs compared to controls.
Exp Paradigm: NA
 Magnetic resonance imaging (mri)
 2-2.5 months
Dendritic architecture: spine morphology1
Abnormal
Description: Mutants show an increase in long thin dendritic spines, a decrease in mushroom spines but no change in stubby spines, compared to controls. mutants show decreased spine length and spine head width compared to controls. mutants show no change in spine morphology in the hippocampus compared to controls.
Exp Paradigm: NA
 Golgi-cox staining
 3 weeks
Cortical thickness1
Decreased
Description: Mutants show the thickness of the ctip2 layer (lower cortical layer) is not changed but the medial and dorsal region of the cortex shows decreases in the thickness of the cux-1-positive layer (upper cortical layer), together with an overall reduced cortex thickness in the dorsal-caudal region, in comparison with controls.
Exp Paradigm: Immunostained for the upper cortex marker cux-1 and the lower cortex marker ctip2 to analyze laminar organization including thickness and density of cortical layers.
 Immunostaining
 2-2.5 months
Dendritic architecture: spine density1
Decreased
Description: Mutant neurons had significant changes in spine distribution and a reduction in the total number of basal dendrite spines per pfc neuron, compared to controls.
Exp Paradigm: NA
 Golgi-cox staining
 3 weeks
Cortical lamination1
Decreased
Description: Mutants show no change in the gross organization of cortical layers compared to controls. mutants show cux-1+ cells (upper cortical layer marker) clustered more in the superficial portion of the upper cortical plate, especially in the medial-caudal and dorsal cortex in comparison with controls, upon detailed examination.
Exp Paradigm: Immunostained for the upper cortex marker cux-1 and the lower cortex marker ctip2 to analyze laminar organization including thickness and density of cortical layers.
 Immunostaining
 2-2.5 months
Miniature post synaptic current frequency: excitatory1
Decreased
Description: Mutants show reduction in the mean frequency of miniature excitatory postsynaptic currents (mepscs) in the pfc compared to controls.
Exp Paradigm: NA
 Whole-cell patch clamp
 3-4 weeks
Anxiety1
Decreased
Description: Mutants spend more time traveling in the open arms of the elevated plus maze in comparison with controls.
Exp Paradigm: NA
 Elevated plus maze test
 2-2.5 months
Cued or contextual fear conditioning: memory of context: long term recall1
Decreased
Description: Mutant male mice spent less time immobile compared with wt male littermates, indicating oss of taok2 impairs consolidation or retention of emotional memories specifically in male mice.
Exp Paradigm: NA
 Fear conditioning test
 2-2.5 months
Cued or contextual fear conditioning: memory of context1
Increased
Description: Mutant males show increased immobility compared to controls.
Exp Paradigm: NA
 Fear conditioning test
 2-2.5 months
Protein phosphorylation1
Decreased
Description: Mutants show decrease in taok2 phosphorylation in different regions in the brain, compared to controls.
Exp Paradigm: NA
 Western blot
 3 weeks
Targeted expression1
Decreased
Description: Mutants show reduced expression of taok2 in all regions of the brain compared to controls.
Exp Paradigm: NA
 Western blot
 3 weeks
Anxiety1
 No change
 Open field test
 2-2.5 months
Anxiety1
 No change
 Elevated plus maze test
 2-2.5 months
Thigmotaxis1
 No change
 Morris water maze test
 2-2.5 months
Cued or contextual fear conditioning: memory of context1
 No change
 Fear conditioning test
 2-2.5 months
Cued or contextual fear conditioning: memory of context: long term recall1
 No change
 Fear conditioning test
 2-2.5 months
Object recognition memory1
 No change
 Object-place recognition test
 2-2.5 months
Spatial reference memory1
 No change
 Morris water maze test
 2-2.5 months
Spatial working memory1
 No change
 Y-maze test
 2-2.5 months
Spatial working memory1
 No change
 Morris water maze test
 2-2.5 months
Swim distance1
 No change
 Morris water maze test
 2-2.5 months
General locomotor activity: ambulatory activity1
 No change
 Open field test
 2-2.5 months
General locomotor activity: ambulatory activity1
 No change
 Object-place recognition test
 2-2.5 months
Swimming ability1
 No change
 Morris water maze test
 2-2.5 months
Dendritic architecture: spine density1
 No change
 Golgi-cox staining
 3 weeks
Morphology and size of the corpus callosum1
 No change
 Diffusion tensor imaging (dti)
 1 week, 1 month, 4 months, 13 months
Neocortex morphology1
 No change
 Immunostaining
 2-2.5 months
Miniature post synaptic current amplitude: excitatory1
 No change
 Whole-cell patch clamp
 3-4 weeks
Miniature post synaptic current amplitude: inhibitory1
 No change
 Whole-cell patch clamp
 3-4 weeks
Miniature post synaptic current frequency: inhibitory1
 No change
 Whole-cell patch clamp
 3-4 weeks
Social approach1
 No change
 Three-chamber social approach test
 2-2.5 months
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Maternal behavior, Physiological parameters, Repetitive behavior, Seizure, Sensory

M_TAOK2_3_KO_HM

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Neuronal migration1
Decreased
Description: Taok2-deficient cells exhibited a significant decrease in migration speed after acute downregulation of Taok2compared with wildtype cortices.
Exp Paradigm: Venus
 Time-lapse fluorescence microscopy
 E18
Neuronal migration1
Decreased
Description: In Taok2 knockout mouse cortices at E19, migrating neurons were held back at the intermediate zone, whereas wildtype neurons were able to reach the cortical plate. No differences in the ventricular zone or intermediate zone were observed at E18.
Exp Paradigm: Venus
 Fluorescence microscopy
 E18-E19
Neocortex morphology: size1
Decreased
Description: A longitudinal study using magnetic resonance imaging (MRI) revealed that the cortex of Taok2 knockout mice shows a significant reduction in volume throughout development concomitant with a higher cortex curvature, from early postnatal development until adulthood.
 Magnetic resonance imaging (MRI)
 P8- 52 weeks
Neuronal migration1
Decreased
Description: Venus-labeled neurons in the knockout cortices showed a more superficial position at P21 compared with wildtype littermates.
Exp Paradigm: Venus
 Fluorescence microscopy
 3 weeks
Cortical thickness1
Decreased
Description: Taok2 knockout mice displayed decreased cortical plate thickness compared to wildtype littermates. However, there were no differences in the thickness of either the ventricular zone or intermediate zone in Taok2 knockout mice.
 Histology
 E18
Brain cytoarchitecture1
 No change
 Immunohistochemistry
 E16
Cortical lamination1
 No change
 Immunohistochemistry
 3, 16 weeks
 Not Reported:

M_TAOK2_4_KO_HT

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Neuronal migration1
Decreased
Description: Taok2-deficient cells exhibited a significant decrease in migration speed in labeled neurons in Het cortices compared with wildtype cortices.
Exp Paradigm: Venus
 Time-lapse fluorescence microscopy
 E18
Neuronal migration1
Decreased
Description: In Taok2 heterozygous mouse cortices at E19, migrating neurons were held back at the intermediate zone, whereas wildtype neurons were able to reach the cortical plate. No differences in the ventricular zone or intermediate zone were observed at E18.
Exp Paradigm: Venus
 Fluorescence microscopy
 E18-E19
Neocortex morphology: size1
Decreased
Description: A longitudinal study using magnetic resonance imaging (MRI) revealed that the cortex of Taok2 heterozygous mice shows a significant reduction in volume throughout development concomitant with a higher cortex curvature, from early postnatal development until adulthood.
 Magnetic resonance imaging (MRI)
 P8- 52 weeks
Cortical lamination1
 No change
 Immunohistochemistry
 3, 16 weeks
Neuronal migration1
 No change
 Fluorescence microscopy
 3 weeks
 Not Reported:

M_TAOK2_5_KD

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Neuronal migration1
Decreased
Description: Taok2-deficient cells exhibited a significant decrease in migration speed after acute downregulation of Taok2 compared with control cortices.
Exp Paradigm: Venus
 Time-lapse fluorescence microscopy
 E18
Neuronal migration1
Decreased
Description: Taok2 shRNA-transfected neurons reached a higher position toward the pia than the control-transfected cells on the contralateral side. Populations of Taok2-downregulated neurons and contralateral control-transfected neurons both expressed Cux-1, thus, Taok2 deficiency does not affect layer identity.
Exp Paradigm: Venus
 Fluorescence microscopy
 P7
Neuronal migration1
Decreased
Description: In the Taok2 knockdown model, through expression of Taok2 shRNA in postmitotic cells, there was a change in the distribution of transfected cells in the developing cortex, with more cells in the intermediate zone and fewer in the cortical plate than in control-transfected cortices.
Exp Paradigm: GFP
 Immunohistochemistry
 E16
Neuronal morphology1
Abnormal
Description: There was a greater proportion of round cells present after Taok2 downregulation compared with control-transfected cells at E18. However, this effect was no longer detectable at E19. The ratio of length/width was significantly decreased in Taok2 shRNA cells at E18 compared with control cells but not at E19. In addition, the leading process width was significantly thinner in Taok2 shRNA cells at E19 compared with control-transfected cells.
Exp Paradigm: Venus
 Fluorescence microscopy
 E18-E19
Neuronal migration1
Decreased
Description: In mouse cortices after Taok2 downregulation at E19, migrating neurons were held back at the intermediate zone, whereas control neurons were able to reach the cortical plate. No differences in the ventricular zone or intermediate zone were observed at E18.
Exp Paradigm: Venus
 Fluorescence microscopy
 E18-E19
 Not Reported:

M_TAOK2_6_KI_A135P

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Neuronal migration1
Decreased
Description: The rate of cells transfected with TAOK2alphaA135P and TAOK2alphaA335V in the intermediate zone increased compared with that of control-transfected cortices or cells expressing TAOK2alphaWT.
Exp Paradigm: Venus
 Fluorescence microscopy
 E19
 Not Reported:

 

No Interactions Available
HELP
Copyright © 2017 MindSpec, Inc.