HELP     Sign In
Search

Relevance to Autism

De novo missense variants and rare inherited loss-of-function (LoF) variants in the MUC4 gene were identified in ASD probands from the Simons Simplex Collection and the Autism Sequencing Consortium (Iossifov et al., 2012; De Rubeis et al., 2014; Iossifov et al., 2014; Krumm et al., 2015). Targeted sequencing of 536 Chinese ASD probands and 1457 Chinese controls in Guo et al., 2017 identified additional rare inherited LoF and damaging missense variants in this gene in ASD probands. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of Chinese ASD probands and controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, identified MUC4 as an ASD candidate gene with a PTADA of 0.000105.

Molecular Function

The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface, although secreted isoforms may exist.

External Links

        

References

Type
Title
Type of Disorder
Associated Disorders
Author, Year
Primary
De novo gene disruptions in children on the autistic spectrum.
ASD
Support
Exome sequencing of 457 autism families recruited online provides evidence for autism risk genes.
ASD
Support
Inherited and De Novo Genetic Risk for Autism Impacts Shared Networks.
ASD
Support
Excess of rare, inherited truncating mutations in autism.
ASD
Support
The contribution of de novo coding mutations to autism spectrum disorder.
ASD
Support
Synaptic, transcriptional and chromatin genes disrupted in autism.
ASD
Recent Recommendation
Targeted sequencing and functional analysis reveal brain-size-related genes and their networks in autism spectrum disorders.
ASD

Rare

Variant ID
Variant Type
Allele Change
Residue Change
Inheritance Pattern
Inheritance Association
Family Type
Author, Year
 GEN943R001 
 missense_variant 
 c.9023C>T 
 p.Ser3008Phe 
 De novo 
 NA 
 Simplex 
 GEN943R002 
 missense_variant 
 c.2454C>A 
 p.Ser818Arg 
 De novo 
 NA 
  
 GEN943R003 
 missense_variant 
 c.6533C>A 
 p.Pro2178His 
 De novo 
 NA 
 Simplex 
 GEN943R004 
 missense_variant 
 c.3253G>C 
 p.Asp1085His 
 De novo 
 NA 
 Simplex 
 GEN943R005 
 missense_variant 
 c.5683A>T 
 p.Asn1895Tyr 
 De novo 
 NA 
 Simplex 
 GEN943R006 
 frameshift_variant 
 G>GA 
 -4263? 
 Familial 
 Maternal 
 Simplex 
 GEN943R007 
 frameshift_variant 
 G>GCA 
 -4190? 
 Familial 
 Maternal 
 Simplex 
 GEN943R008 
 frameshift_variant 
 C>CA 
 -3906? 
 Familial 
 Maternal 
 Simplex 
 GEN943R009 
 frameshift_variant 
 G>GCGTC 
 -3862D? 
 Familial 
 Paternal 
 Simplex 
 GEN943R010 
 frameshift_variant 
 G>GCGTC 
 -3862D? 
 Familial 
 Paternal 
 Simplex 
 GEN943R011 
 frameshift_variant 
 GCCTGACC>G 
 -3132 
 Familial 
 Paternal 
 Simplex 
 GEN943R012 
 frameshift_variant 
 GCC>G 
 -3133 
 Familial 
 Paternal 
 Simplex 
 GEN943R013 
 frameshift_variant 
 A>AGGGGTGGCGT 
 -3008TPP? 
 Familial 
 Paternal 
 Simplex 
 GEN943R014 
 frameshift_variant 
 GCA>G 
 -2829 
 Familial 
 Maternal 
 Simplex 
 GEN943R015 
 frameshift_variant 
 G>GCA 
 -2750? 
 Familial 
 Maternal 
 Simplex 
 GEN943R016 
 frameshift_variant 
 G>GCA 
 -2750? 
 Familial 
 Paternal 
 Simplex 
 GEN943R017 
 frameshift_variant 
 G>GCA 
 -2750? 
 Familial 
 Paternal 
 Simplex 
 GEN943R018 
 frameshift_variant 
 G>GCA 
 -2750? 
 Familial 
 Maternal 
 Simplex 
 GEN943R019 
 frameshift_variant 
 G>GCA 
 -2750? 
 Familial 
 Maternal 
 Simplex 
 GEN943R020 
 frameshift_variant 
 G>GCA 
 -2750? 
 Familial 
 Maternal 
 Simplex 
 GEN943R021 
 frameshift_variant 
 G>GCA 
 -2750? 
 Familial 
 Maternal 
 Simplex 
 GEN943R022 
 frameshift_variant 
 G>GCA 
 -2750? 
 Familial 
 Paternal 
 Simplex 
 GEN943R023 
 frameshift_variant 
 G>GCA 
 -2750? 
 Familial 
 Paternal 
 Simplex 
 GEN943R024 
 frameshift_variant 
 A>AAGGCT 
 -2742S? 
 Familial 
 Paternal 
 Simplex 
 GEN943R025 
 frameshift_variant 
 GTGTATGCTGAGGAAGTGTCGGTGACAGGAAGAGAGGTGGTGTC>G 
 -2701 
 Familial 
 Paternal 
 Simplex 
 GEN943R026 
 frameshift_variant 
 GTGTATGCTGAGGAAGTGTCGGTGACAGGAAGAGAGGTGGTGTC>G 
 -2701 
 Familial 
 Paternal 
 Simplex 
 GEN943R027 
 frameshift_variant 
 GTGTCA>G 
 -2700 
 Familial 
 Paternal 
 Simplex 
 GEN943R028 
 frameshift_variant 
 GTGTCA>G 
 -2700 
 Familial 
 Maternal 
 Simplex 
 GEN943R029 
 frameshift_variant 
 GTGTCA>G 
 -2700 
 Familial 
 Maternal 
 Simplex 
 GEN943R030 
 frameshift_variant 
 A>AC 
 -2064? 
 Familial 
 Maternal 
 Simplex 
 GEN943R031 
 frameshift_variant 
 G>GC 
 -1749? 
 Familial 
 Maternal 
 Simplex 
 GEN943R032 
 frameshift_variant 
 G>GA 
 -1743? 
 Familial 
 Maternal 
 Simplex 
 GEN943R033 
 frameshift_variant 
 G>GA 
 -1743? 
 Familial 
 Maternal 
 Simplex 
 GEN943R034 
 frameshift_variant 
 G>GA 
 -1743? 
 Familial 
 Maternal 
 Simplex 
 GEN943R035 
 frameshift_variant 
 A>ATT 
 -1670? 
 Familial 
 Paternal 
 Simplex 
 GEN943R036 
 frameshift_variant 
 A>ATT 
 -1670? 
 Familial 
 Maternal 
 Simplex 
 GEN943R037 
 frameshift_variant 
 G>GT 
 -1669? 
 Familial 
 Maternal 
 Simplex 
 GEN943R038 
 frameshift_variant 
 G>GT 
 -1669? 
 Familial 
 Maternal 
 Simplex 
 GEN943R039 
 frameshift_variant 
 G>GT 
 -1669? 
 Familial 
 Maternal 
 Simplex 
 GEN943R040 
 frameshift_variant 
 GTGTGA>G 
 -1612 
 Familial 
 Maternal 
 Simplex 
 GEN943R041 
 frameshift_variant 
 GTGTGA>G 
 -1612 
 Familial 
 Maternal 
 Simplex 
 GEN943R042 
 frameshift_variant 
 G>GTC 
 -1372? 
 Familial 
 Maternal 
 Simplex 
 GEN943R043 
 frameshift_variant 
 T>TGACCTGTGGA 
 -973STG? 
 Familial 
 Paternal 
 Simplex 
 GEN943R044 
 frameshift_variant 
 T>TGACCTGTGGA 
 -973STG? 
 Familial 
 Maternal 
 Simplex 
 GEN943R045 
 frameshift_variant 
 CA>C 
 -11 
 Familial 
 Maternal 
 Simplex 
 GEN943R046 
 frameshift_variant 
 CA>C 
 -11 
 Familial 
 Paternal 
 Simplex 
 GEN943R047 
 splice_site_variant 
 ATCTGAAGTAAGCCTTCAGCGTGCTCACGTTCACTG>A 
 p.? 
 Familial 
 Paternal 
 Simplex 
 GEN943R048 
 stop_gained 
 c.3235C>T 
 p.Gln1079Ter 
 Familial 
 Paternal 
 Simplex 
 GEN943R049 
 stop_gained 
 c.2935C>T 
 p.Arg979Ter 
 Familial 
 Maternal 
 Simplex 
 GEN943R050 
 stop_gained 
 C>A 
 p.Glu859Ter 
 Familial 
 Maternal 
 Simplex 
 GEN943R051 
 stop_gained 
 C>A 
 p.Glu859Ter 
 Familial 
 Maternal 
 Simplex 
 GEN943R052 
 stop_gained 
 C>A 
 p.Glu859Ter 
 Familial 
 Paternal 
 Simplex 
 GEN943R053 
 stop_gained 
 A>ATAC 
 p.Ala3753AlaTer 
 Familial 
 Maternal 
 Simplex 
 GEN943R054 
 stop_gained 
 c.83-3070C>G 
  
 Familial 
 Maternal 
 Simplex 
 GEN943R055 
 stop_gained 
 G>T 
 p.Ser2424Ter 
 Familial 
 Paternal 
 Simplex 
 GEN943R056 
 stop_gained 
 G>T 
 p.Ser2424Ter 
 Familial 
 Maternal 
 Simplex 
 GEN943R057 
 stop_gained 
 c.83-5854C>A 
  
 Familial 
 Paternal 
 Simplex 
 GEN943R058 
 stop_gained 
 c.83-6910C>A 
  
 Familial 
 Maternal 
 Simplex 
 GEN943R059 
 stop_gained 
 c.83-10030C>G 
  
 Familial 
 Paternal 
 Simplex 
 GEN943R060 
 stop_gained 
 G>C 
 p.Ser960Ter 
 Familial 
 Maternal 
 Simplex 
 GEN943R061 
 frameshift_variant 
 T>TG 
 -913? 
 Familial 
 Maternal 
 Simplex 
 GEN943R062 
 frameshift_variant 
 TC>T 
 -97 
 Familial 
 Maternal 
 Simplex 
 GEN943R063 
 frameshift_variant 
 G>GGTGTC 
 -4174D? 
 Familial 
 Paternal 
 Simplex 
 GEN943R064 
 frameshift_variant 
 G>GGTGTC 
 -4174D? 
 Familial 
 Paternal 
 Simplex 
 GEN943R065 
 frameshift_variant 
 T>TGCTG 
 -3993Q? 
 Familial 
 Maternal 
 Simplex 
 GEN943R066 
 frameshift_variant 
 GCA>G,GCG,GCC 
 -3933 
 Familial 
 Paternal 
 Simplex 
 GEN943R067 
 frameshift_variant 
 C>CA 
 -3906? 
 Familial 
 Maternal 
 Simplex 
 GEN943R068 
 frameshift_variant 
 G>GCGTC 
 -3862D? 
 Familial 
 Maternal 
 Simplex 
 GEN943R069 
 frameshift_variant 
 G>GCGTC 
 -3862D? 
 Familial 
 Maternal 
 Simplex 
 GEN943R070 
 frameshift_variant 
 G>GCGTC 
 -3862D? 
 Familial 
 Maternal 
 Simplex 
 GEN943R071 
 frameshift_variant 
 G>GCGTC 
 -3862D? 
 Familial 
 Paternal 
 Simplex 
 GEN943R072 
 frameshift_variant 
 ACCTGTGGATGCTGAGGAAGTGTCCGTGACAGGAAGACG>A 
 -3680 
 Familial 
 Paternal 
 Simplex 
 GEN943R073 
 frameshift_variant 
 GTC>G 
 -3621 
 Familial 
 Paternal 
 Simplex 
 GEN943R074 
 frameshift_variant 
 GCGTC>G 
 -3589 
 Familial 
 Maternal 
 Simplex 
 GEN943R075 
 frameshift_variant 
 G>GGGGTGGC 
 -3008AT? 
 Familial 
 Maternal 
 Simplex 
 GEN943R076 
 frameshift_variant 
 G>GCA 
 -2750? 
 Familial 
 Maternal 
 Simplex 
 GEN943R077 
 frameshift_variant 
 G>GCA 
 -2750? 
 Familial 
 Maternal 
 Simplex 
 GEN943R078 
 frameshift_variant 
 A>AAG 
 -2310? 
 Familial 
 Maternal 
 Simplex 
 GEN943R079 
 frameshift_variant 
 A>ATT 
 -1670? 
 Familial 
 Paternal 
 Simplex 
 GEN943R080 
 frameshift_variant 
 G>GT 
 -1669? 
 Familial 
 Paternal 
 Simplex 
 GEN943R081 
 frameshift_variant 
 G>GT 
 -1669? 
 Familial 
 Maternal 
 Simplex 
 GEN943R082 
 frameshift_variant 
 CA>C 
 -11 
 Familial 
 Maternal 
 Simplex 
 GEN943R083 
 splice_site_variant 
 TCACCCA>CCCCCCC 
 p.? 
 Familial 
 Maternal 
 Simplex 
 GEN943R084 
 splice_site_variant 
 c.236-2A>G 
  
 Familial 
 Paternal 
 Simplex 
 GEN943R085 
 stop_gained 
 C>A 
 p.Glu859Ter 
 Familial 
 Paternal 
 Simplex 
 GEN943R086 
 stop_gained 
 c.2575G>T 
 p.Glu859Ter 
 Familial 
 Maternal 
 Simplex 
 GEN943R087 
 stop_gained 
 c.83-10246C>G 
  
 Familial 
 Paternal 
 Simplex 
 GEN943R088 
 frameshift_variant 
 c.5161_5162insC 
 p.Val1721AlafsTer5 
 Familial 
  
  
 GEN943R089 
 frameshift_variant 
 c.5068_5069insT 
 p.Thr1690IlefsTer4 
 Familial 
  
  
 GEN943R090 
 missense_variant 
 c.1678G>A 
 p.Gly560Arg 
 Familial 
  
  
 GEN943R091 
 frameshift_variant 
 c.292del 
 p.Thr98ProfsTer93 
 Familial 
 Paternal 
 Multiplex 
 GEN943R092 
 synonymous_variant 
 c.2151G>A 
 p.Pro717%3D 
 De novo 
 NA 
  

Common

No Common Variants Available
Chromosome
CNV Locus
CNV Type
# of studies
Animal Model
3
Duplication
 1
 
3
Duplication
 2
 
3
Duplication
 1
 
3
Duplication
 2
 
3
Duplication
 1
 
3
Duplication
 1
 
3
Deletion
 4
 
3
Duplication
 4
 
3
Deletion-Duplication
 55
 

No Animal Model Data Available

No PIN Data Available
HELP
Copyright © 2017 MindSpec, Inc.