HELP     Sign In
Search

Relevance to Autism

Mutations in the MECP2 gene underlie Rett syndrome, an autism spectrum disorder. Some studies have found that rare variations in the MECP2 gene are associated with autism, while others have looked and found no variants in autistic patients. It appears that EGR2 and MECP2 can regulate each other's expression (Swanberg et al., 2009).

Molecular Function

The encoded protein has methylation-dependent transcriptional repressor activity . It is also involved in regulation of RNA splicing.

External Links

        

References

Type
Title
Type of Disorder
Associated Disorders
Author, Year
Primary
Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2.
Rett syndrome
Positive Association
MECP2 structural and 3'-UTR variants in schizophrenia, autism and other psychiatric diseases: a possible association with autism.
ASD
SCZ
Negative Association
No mutations in the coding region of the Rett syndrome gene MECP2 in 59 autistic patients.
Rett syndrome
Support
Effectiveness of exome and genome sequencing guided by acuity of illness for diagnosis of neurodevelopmental disorders.
ID, epilepsy
ADHD
Support
Diagnostic Yields of Trio-WES Accompanied by CNVseq for Rare Neurodevelopmental Disorders.
DD, ID
Support
Yield of Genetic Testing in Children with Autism Spectrum Disorder - A Single-Center Experience
ASD
DD, epilepsy/seizures
Support
Identification of MeCP2 mutations in a series of females with autistic disorder.
ASD
Support
Targeted sequencing and functional analysis reveal brain-size-related genes and their networks in autism spectrum disorders.
ASD
Support
Genetic care in geographically isolated small island communities: 8 years of experience in the Dutch Caribbean
DD
Support
Diagnostic findings and yield of investigations for children with developmental regression
Developmental regression
ASD, ID
Support
The MECP2 variant c.925C>T (p.Arg309Trp) causes intellectual disability in both males and females without classic features of Rett syndrome.
ID
Epilepsy/seizures
Support
Targeted re-sequencing for early diagnosis of genetic causes of childhood epilepsy: the Italian experience from the 'beyond epilepsy' project
DD, epilepsy/seizures
Autistic behavior
Support
ASD
DD, ID, epilepsy/seizures
Support
Mutation of MeCP2 at T158M Leads to Distinct Molecular and Phenotypic Abnormalities in Male and Female Mice
Rett syndrome
ASD
Support
A partial MECP2 duplication in a mildly affected adult male: a putative role for the 3' untranslated region in the MECP2 duplication phenotype.
ASD
ADHD, epilepsy
Support
Both rare and common genetic variants contribute to autism in the Faroe Islands.
ASD
Support
Impaired Neurodevelopmental Genes in Slovenian Autistic Children Elucidate the Comorbidity of Autism With Other Developmental Disorders
DD, ID
Autistic behavior, stereotypy
Support
The Genetic Puzzle of Cerebral Palsy: Results of a Monocentric Study
Cerebral palsy
DD, ID, epilepsy/seizures, stereotypy
Support
Preserved speech variant is allelic of classic Rett syndrome.
Rett syndrome
Support
Asperger syndrome and early-onset schizophrenia associated with a novel MECP2 deleterious missense variant.
ASD
SCZ
Support
Genome sequencing of 320 Chinese children with epilepsy: a clinical and molecular study
ASD, DD, epilepsy/seizures
Support
Purkinje-cell-specific MeCP2 deficiency leads to motor deficits and autistic-like behavior due to aberrations in PTP1B-TrkB-SK signaling
Rett syndrome
Support
Whole-Exome Sequencing Identifies Novel Genetic Variants Associated with Unexplained Neurodevelopmental Disorders in Children
ASD
Support
Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing.
ID
Support
The Clinical and Genetic Features of Co-occurring Epilepsy and Autism Spectrum Disorder in Chinese Children.
ASD, epilepsy/seizures
Support
Genetic variants and phenotypic data curated for the CAGI6 intellectual disability panel challenge
ID
ASD/autistic traits, epilepsy/seizures
Support
Study of MECP2 gene in Rett syndrome variants and autistic girls.
Rett syndrome
ASD
Support
Identification of autism-related MECP2 mutations by whole-exome sequencing and functional validation.
ASD
Support
Identification of Region-Specific Cytoskeletal and Molecular Alterations in Astrocytes of Mecp2 Deficient Animals
Rett syndrome
Support
The utility of exome sequencing in diagnosing pediatric neurodevelopmental disorders in a highly consanguineous population
DD
ASD, epilepsy/seizures
Support
Comprehensive molecular testing in patients with high functioning autism spectrum disorder.
ASD
Support
Next-Generation Sequencing in Korean Children With Autism Spectrum Disorder and Comorbid Epilepsy
ASD
Epilepsy/seizures, Rett syndrome
Support
DD, epilepsy/seizures
Support
Prospective study to analyze the yield and clinical impact of trio exome sequencing in 137 Indian children with autism spectrum disorder
ASD
DD
Support
Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.
ASD
Support
Inherited and multiple de novo mutations in autism/developmental delay risk genes suggest a multifactorial model.
ASD
Support
Clinical Targeted Panel Sequencing Analysis in Clinical Evaluation of Children with Autism Spectrum Disorder in China
ASD
Support
Genetic Diagnostic Yield in Autism Spectrum Disorder (ASD) and Epilepsy Phenotypes in Children with Genetically Defined ASD
ASD
ADHD, DD, ID, epilepsy/seizures
Support
Diagnostic Targeted Resequencing in 349 Patients with Drug-Resistant Pediatric Epilepsies Identifies Causative Mutations in 30 Different Genes.
Epilepsy/seizures
Rett syndrome
Support
Comorbidities associated with genetic abnormalities in children with intellectual disability
ASD, DD/ID
Support
MeCP2 represses the activity of topoisomerase IIβ in long neuronal genes
Support
Using the linear references from the pangenome to discover missing autism variants
ASD
Support
De novo mutations in schizophrenia implicate chromatin remodeling and support a genetic overlap with autism and intellectual disability.
SCZ
Support
Comprehensive Analysis of Rare Variants of 101 Autism-Linked Genes in a Hungarian Cohort of Autism Spectrum Disorder Patients.
ASD
Rett syndrome
Support
MECP2 duplication syndrome
Support
Structural variant allelic heterogeneity in MECP2 duplication syndrome provides insight into clinical severity and variability of disease expression
Lubs-type X-linked syndromic intellectual developm
Support
Neurodevelopmental disorders in males related to the gene causing Rett syndrome in females (MECP2).
ID
Support
Genomic diagnosis for children with intellectual disability and/or developmental delay.
ASD, ID, epilepsy/seizures
Support
Astrocytic Gap Junctions Contribute to Aberrant Neuronal Synchronization in a Mouse Model of MeCP2 Duplication Syndrome
MECP2 duplication syndrome
Support
Genetic and phenotypic landscape of pediatric-onset epilepsy in 142 Indian families: Counseling and therapeutic implications
Epilepsy/seizures
DD
Support
Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients.
DD, epilepsy/seizures
Developmental regression, hypotonia
Support
Phenotypic and genetic spectrum of epilepsy with myoclonic atonic seizures
ID, epilepsy/seizures
Support
Diagnostic yield of clinical exome sequencing in 868 children with neurodevelopmental disorders
Autistic behavior
DD, epilepsy/seizures, stereotypy
Support
A MECP2 missense mutation within the MBD domain in a Brazilian male with autistic disorder.
ASD
Support
Mosaic MECP2 variants in males with classical Rett syndrome features, including stereotypical hand movements.
Rett syndrome
Support
Genetic and Phenotype Analysis of a Chinese Cohort of Infants and Children With Epilepsy
Epilepsy/seizures
ASD, DD, ID
Support
Next-generation phenotyping integrated in a national framework for patients with ultrarare disorders improves genetic diagnostics and yields new molecular findings
DD
ID, epilepsy/seizures, stereotypy
Support
Clinical exome sequencing: results from 2819 samples reflecting 1000 families.
Rett syndrome
DD, ID, hypotonia
Support
De novo variants in neurodevelopmental disorders-experiences from a tertiary care center
DD, epilepsy/seizures
Support
Clinical Utility of Proband Only Clinical Exome Sequencing in Neurodevelopmental Disorders
ASD
ADHD, DD, ID, epilepsy/seizures
Support
Multilayered genetic dissection of autism: insights from whole-exome sequencing, molecular karyotyping, and cytogenetic analyses in a small Turkish cohort
ASD
Support
Using whole-exome sequencing to identify inherited causes of autism.
ASD
Support
Lessons Learned from Large-Scale, First-Tier Clinical Exome Sequencing in a Highly Consanguineous Population.
DD, ID
Epilepsy/seizures, ASD, stereotypies
Support
Unveiling genetic insights: Array-CGH and WES discoveries in a cohort of 122 children with essential autism spectrum disorder
ASD
Support
In-frame deletion in MECP2 causes mild nonspecific mental retardation.
ID
Support
Mapping autosomal recessive intellectual disability: combined microarray and exome sequencing identifies 26 novel candidate genes in 192 consanguin...
ID
Support
Autism spectrum disorder and comorbid neurodevelopmental disorders (ASD-NDDs): Clinical and genetic profile of a pediatric cohort
ASD
DD, ID, epilepsy/seizures
Support
Exome sequencing improves the molecular diagnostics of paediatric unexplained neurodevelopmental disorders
DD, ID
Support
MECP2 missense mutations outside the canonical MBD and TRD domains in males with intellectual disability.
ID
ASD
Support
Rare genetic susceptibility variants assessment in autism spectrum disorder: detection rate and practical use.
ASD
Support
Exome Study of Single Nucleotide Variations in Patients with Syndromic and Non-Syndromic Autism Reveals Potential Candidate Genes for Diagnostics and Novel Single Nucleotide Variants
ASD
DD, epilepsy/seizures
Support
A novel familial MECP2 mutation in a young boy: clinical and molecular findings.
ID
Epilepsy
Support
Diagnostic value of partial exome sequencing in developmental disorders.
DD
Support
Diagnostic yield of patients with undiagnosed intellectual disability
DD, ID
Support
The impact of inversions across 33,924 families with rare disease from a national genome sequencing project
DD, ID, epilepsy/seizures
Autistic features, stereotypy
Support
De novo genic mutations among a Chinese autism spectrum disorder cohort.
ASD
Support
Genome sequencing broadens the range of contributing variants with clinical implications in schizophrenia
SCZ
Support
Non-canonical C-terminal variant of MeCP2 R344W exhibits enhanced degradation rate
Atypcial Rett syndrome, ASD, DD
Support
Double Genetic Diagnosis Involving MECP2 and EPHB4 in a Child with Neurodevelopmental Delay and Vascular Anomalies: A Case Report
Rett syndrome, ASD, DD
Support
Rare complete knockouts in humans: population distribution and significant role in autism spectrum disorders.
ASD
Support
Neurological Diseases With Autism Spectrum Disorder: Role of ASD Risk Genes.
ASD
ID, epilepsy/seizures
Support
Aberrant brain functional and structural developments in MECP2 duplication rats
MECP2 duplication syndrome
Support
The genetic landscape of autism spectrum disorder in an ancestrally diverse cohort
ASD
Support
MECP2 is highly mutated in X-linked mental retardation.
ID
Support
Familial cases and male cases with MECP2 mutations.
Rett syndrome, X-linked intellectual disability
Support
Genetic Testing in Patients with Neurodevelopmental Disorders: Experience of 511 Patients at Cincinnati Children's Hospital Medical Center
ASD, DD
Epilepsy/seizures
Support
Whole Exome Sequencing as a First-Line Molecular Genetic Test in Developmental and Epileptic Encephalopathies
ID, epilepsy/seizures
Support
Mutations in epilepsy and intellectual disability genes in patients with features of Rett syndrome.
Rett syndrome
Epilepsy
Support
Exome sequencing of 457 autism families recruited online provides evidence for autism risk genes
ASD
Support
ASD
Support
Revealing function-altering MECP2 mutations in individuals with autism spectrum disorder using yeast and Drosophila
ASD
Support
Submicroscopic duplication in Xq28 causes increased expression of the MECP2 gene in a boy with severe mental retardation and features of Rett syndr...
ID
RTT
Support
Diagnostic exome sequencing of syndromic epilepsy patients in clinical practice.
DD, epilepsy/seizures
Support
Trio-based exome sequencing reveals a high rate of the de novo variants in intellectual disability
ID
Support
Phenotypic and genetic analysis of children with unexplained neurodevelopmental delay and neurodevelopmental comorbidities in a Chinese cohort using trio-based whole-exome sequencing
DD, ID
ASD, ADHD, epilepsy/seizures
Support
Identification of a RAI1-associated disease network through integration of exome sequencing, transcriptomics, and 3D genomics.
DD
Behavioral abnormalities (self-injurious, aggressi
Support
Graded and pan-neural disease phenotypes of Rett Syndrome linked with dosage of functional MeCP2
Support
Prospect of genetic disorders in Saudi Arabia
DD
Support
Predicting the diagnostic efficacy of trio-based whole exome sequencing in children with low-function autism spectrum disorders: a multicenter study
ASD, DD/ID
ADHD
Support
The expanding role of MBD genes in autism: identification of a MECP2 duplication and novel alterations in MBD5, MBD6, and SETDB1.
ASD
Support
The combination of whole-exome sequencing and copy number variation sequencing enables the diagnosis of rare neurological disorders.
DD, ID
ASD, epilepsy/seizures
Support
Integrating de novo and inherited variants in 42
ASD
Support
Trio-whole exome sequencing reveals the importance of de novo variants in children with intellectual disability and developmental delay
ASD, DD
Epilepsy/seizures
Support
MECP2 mutation in male patients with non-specific X-linked mental retardation.
ID
Support
A clinical utility study of exome sequencing versus conventional genetic testing in pediatric neurology.
DD
Support
Detecting cryptic clinically relevant structural variation in exome-sequencing data increases diagnostic yield for developmental disorders
DD, ID, epilepsy/seizures
Support
The developmental timing of spinal touch processing alterations predicts behavioral changes in genetic mouse models of autism spectrum disorders
ASD
Somatosensory behaviors
Support
A novel heterozygous pathogenic variation in the MECP2 gene causing typical Rett syndrome: a case report
Rett syndrome, DD
Stereotypy
Support
Large-scale discovery of novel genetic causes of developmental disorders.
DD
Stereotypic behavior
Support
Characterization of intellectual disability and autism comorbidity through gene panel sequencing.
ID, ASD or autistic traits
Support
Autistic-like behaviors and impaired chronic inflammatory pain in primary nociceptive neuron-specific deletion of Mecp2 or Fmr1 knockout male mice
ASD
Support
Chromosome 2 deletion encompassing the MAP2 gene in a patient with autism and Rett-like features.
ASD
Support
Clinical and molecular genetic characterization of familial MECP2 duplication syndrome in a Chinese family.
MECP2 duplication syndrome
ASD, ID, epilepsy/seizures
Support
Deep phenotyping and whole-exome sequencing improved the diagnostic yield for nuclear pedigrees with neurodevelopmental disorders
ADHD, DD, ID
Support
Behavioral and transcriptomic analyses of mecp2 function in zebrafish
Rett syndrome
Support
Identification of Intellectual Disability Genes in Female Patients with A Skewed X Inactivation Pattern.
ID
Support
Next Generation Sequencing of 134 Children with Autism Spectrum Disorder and Regression
ASD
Developmental regression, epilepsy/seizures
Support
ASD, ID, epilepsy/seizures
Support
Rare Variant Burden and Behavioral Phenotypes in Children with Autism in Slovakia
ASD
Support
Range of genetic mutations associated with severe non-syndromic sporadic intellectual disability: an exome sequencing study.
ID
Epilepsy, ASD
Support
Elucidation of the phenotypic spectrum and genetic landscape in primary and secondary microcephaly.
Microcephaly
DD, ID
Support
Comprehensive genome sequencing analyses identify novel gene mutations and copy number variations associated with infant developmental delay or intellectual disability (DD/ID)
DD, ID
Stereotypy
Support
Genomic insights from a deeply phenotyped highly consanguineous neurodevelopmental disorders cohort
DD, epilepsy/seizures
ASD or autistic behavior, ID
Support
A mutation in the rett syndrome gene, MECP2, causes X-linked mental retardation and progressive spasticity in males.
ID
Support
Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder
ASD
Rett syndrome
Support
Report of a novel missense mutation in the MECP2 gene in a middle-aged man with intellectual disability syndrome
DD, ID, epilepsy/seizures
Support
Decoding complex inherited phenotypes in rare disorders: the DECIPHERD initiative for rare undiagnosed diseases in Chile
ASD, ID
Support
Genetic Traces in Autism Spectrum Disorders: A Whole Exome Sequencing Study from Türkiye
ASD
DD, epilepsy/seizures
Highly Cited
Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex.
Highly Cited
MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin.
Recent Recommendation
Activity-dependent phosphorylation of MeCP2 threonine 308 regulates interaction with NCoR.
Recent Recommendation
Deletion of Mecp2 in Sim1-expressing neurons reveals a critical role for MeCP2 in feeding behavior, aggression, and the response to stress.
Recent Recommendation
Disruption of MeCP2-TCF20 complex underlies distinct neurodevelopmental disorders
Rett syndrome
Recent Recommendation
L1 retrotransposition in neurons is modulated by MeCP2.
Recent Recommendation
Rett syndrome mutations abolish the interaction of MeCP2 with the NCoR/SMRT co-repressor.
Recent Recommendation
Genetic modifiers of MeCP2 function in Drosophila.
Recent Recommendation
Further delineation of the MECP2 duplication syndrome phenotype in 59 French male patients, with a particular focus on morphological and neurologic...
MECP2 duplication syndrome
Stereotypic movements
Recent Recommendation
Dysfunction in GABA signalling mediates autism-like stereotypies and Rett syndrome phenotypes.
Recent Recommendation
An AT-hook domain in MeCP2 determines the clinical course of Rett syndrome and related disorders.
Recent Recommendation
A MECP2 mutation in a highly conserved aminoacid causing mental retardation in a male.
ID
Recent Recommendation
GluD1 is a common altered player in neuronal differentiation from both MECP2-mutated and CDKL5-mutated iPS cells.
Recent Recommendation
Neuronal MeCP2 is expressed at near histone-octamer levels and globally alters the chromatin state.
Recent Recommendation
Bisphenol A delays the perinatal chloride shift in cortical neurons by epigenetic effects on the Kcc2 promoter.
Recent Recommendation
Increased binding of MeCP2 to the GAD1 and RELN promoters may be mediated by an enrichment of 5-hmC in autism spectrum disorder (ASD) cerebellum.
Recent Recommendation
MeCP2 deficiency disrupts axonal guidance, fasciculation, and targeting by altering Semaphorin 3F function.
Recent Recommendation
MeCP2 binds to 5hmC enriched within active genes and accessible chromatin in the nervous system.
Recent Recommendation
Oligodendrocyte lineage cells contribute unique features to Rett syndrome neuropathology.
Recent Recommendation
Reciprocal co-regulation of EGR2 and MECP2 is disrupted in Rett syndrome and autism.
ASD, RTT
Recent Recommendation
MeCP2 regulates telencephalic development in human cerebral organoids
Rett syndrome
ASD
Recent Recommendation
Overexpression of methyl-CpG binding protein 2 impairs T(H)1 responses.
Recent Recommendation
Transcriptional regulation of the MET receptor tyrosine kinase gene by MeCP2 and sex-specific expression in autism and Rett syndrome.
Recent Recommendation
MECP2 genomic structure and function: insights from ENCODE.
Recent Recommendation
MECP2 directly interacts with RNA polymerase II to modulate transcription in human neurons
Rett syndrome
Recent Recommendation
Genome-wide activity-dependent MeCP2 phosphorylation regulates nervous system development and function.

Rare

Variant ID
Variant Type
Allele Change
Residue Change
Inheritance Pattern
Inheritance Association
Family Type
Author, Year
 GEN157R001 
 missense_variant 
 c.397C>A 
 p.Arg133Cys 
 De novo 
  
 Simplex 
 GEN157R002 
 missense_variant 
 c.464T>C 
 p.Phe155Ser 
 De novo 
  
 Simplex 
 GEN157R003 
 missense_variant 
 c.473C>T 
 p.Thr158Met 
 De novo 
  
 Simplex 
 GEN157R004 
 stop_gained 
 c.837C>T 
  
 De novo 
  
 Simplex 
 GEN157R005 
 frameshift_variant 
 c.694insT 
 Stop after 27 out of frame AA's 
 Unknown 
 Not maternal 
 Simplex 
 GEN157R006 
 missense_variant 
 c.316C>T 
 p.Arg106Trp 
 Unknown 
 Not maternal 
 Multiplex 
 GEN157R007 
 synonymous_variant 
 c.656C>T 
 p.(=) 
 Familial 
 Paternal 
 Multiplex 
 GEN157R008 
 synonymous_variant 
 c.1307C>T 
 p.(=) 
 Unknown 
 Not maternal 
 Simplex 
 GEN157R009 
 missense_variant 
 c.1214C>T 
 p.Pro405Leu 
 De novo 
  
  
 GEN157R010 
 missense_variant 
 c.587C>G 
 p.Thr196Ser 
  
  
  
 GEN157R011 
 missense_variant 
 c.1127C>G 
 p.Pro376Arg 
  
  
  
 GEN157R012 
 frameshift_variant 
 c.1558insA 
  
  
  
  
 GEN157R013 
 missense_variant 
 c.1127C>G 
 p.Pro376Arg 
  
  
  
 GEN157R014 
 3_prime_UTR_variant 
 c.6809T>C 
  
 Familial 
 Maternal 
  
 GEN157R015 
 3_prime_UTR_variant 
 c.1638G>C 
  
 Familial 
 Maternal 
  
 GEN157R016 
 frameshift_variant 
 c.1193_1233del 
 p.Leu398HisfsTer5 
 De novo 
  
  
 GEN157R017 
 stop_gained 
 c.880C>T 
 p.Arg294Ter 
 De novo 
  
  
 GEN157R018 
 stop_gained 
 c.1216G>A 
 p.Glu406Lys 
 Familial 
 Maternal 
 Multi-generational 
 GEN157R019 
 missense_variant 
 c.419C>T 
 p.Ala140Val 
 Familial 
 Maternal 
 Multi-generational 
 GEN157R020 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
  
  
  
 GEN157R021 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
  
  
  
 GEN157R022 
 missense_variant 
 c.608C>T 
 p.Pro203Leu 
 Unknown 
  
 Unknown 
 GEN157R023 
 synonymous_variant 
 c.656C>T 
 p.(=) 
  
  
  
 GEN157R024 
 synonymous_variant 
 c.1145C>T 
 p.(=) 
  
  
  
 GEN157R025 
 intron_variant 
 IVS2-61C>G 
  
  
  
  
 GEN157R026 
 missense_variant 
 c.410A>G 
 p.Glu137Gly 
  
  
  
 GEN157R027 
 missense_variant 
 c.499C>T 
 p.Arg167Trp 
 Familial 
 Maternal 
 Multiplex 
 GEN157R028 
 missense_variant 
 c.1196C>T 
 p.Pro399Leu 
  
  
  
 GEN157R029 
 missense_variant 
 c.1358G>A 
 p.Arg453Gln 
  
  
  
 GEN157R030 
 missense_variant 
 c.850A>G 
 p.Lys284Glu 
  
  
  
 GEN157R031 
 intron_variant 
 CT>GT 
  
  
  
  
 GEN157R032 
 synonymous_variant 
 c.849C>G 
 p.(=) 
  
  
  
 GEN157R033 
 synonymous_variant 
 c.897C>T 
 p.Ala299= 
  
  
  
 GEN157R034 
 synonymous_variant 
 c.1035A>G 
 p.(=) 
  
  
  
 GEN157R035 
 synonymous_variant 
 c.1160C>T 
 p.Ser387Phe 
  
  
  
 GEN157R036 
 inframe_deletion 
 c.1161_1400del 
 p.Pro388_Glu467del 
 Familial 
 Maternal 
  
 GEN157R037 
 copy_number_gain 
  
  
 Familial 
 Maternal 
 Simplex 
 GEN157R038 
 missense_variant 
 c.674C>T 
 p.Pro225Leu 
 De novo 
  
  
 GEN157R039 
 missense_variant 
 c.964C>T 
 p.Pro322Ser 
 Familial 
 Maternal 
  
 GEN157R040 
 missense_variant 
 c.479C>G 
 p.Thr160Arg 
  
  
  
 GEN157R041 
 synonymous_variant 
 c.582C>T 
 p.(=) 
  
  
  
 GEN157R042 
 missense_variant 
 c.1189G>A 
 p.Glu397Lys 
  
  
  
 GEN157R043 
 synonymous_variant 
 c.1233C>T 
 p.Pro411= 
  
  
  
 GEN157R044 
 missense_variant 
 c.641C>G 
 p.Ala214Gly 
 Familial 
 Maternal 
 Simplex 
 GEN157R045 
 synonymous_variant 
 c.819G>T 
 p.(=) 
 Familial 
 Paternal 
  
 GEN157R046 
 copy_number_gain 
  
  
 Familial 
 Paternal 
 Multiplex 
 GEN157R047 
 missense_variant 
 c.719C>G 
 p.Thr240Ser 
 Familial 
 Maternal 
 Multiplex 
 GEN157R048 
 missense_variant 
 c.719C>G 
 p.Thr240Ser 
 Familial 
 Maternal 
 Simplex 
 GEN157R049 
 missense_variant 
 c.1108G>A 
 p.Ala370Thr 
 Familial 
 Maternal 
 Simplex 
 GEN157R050 
 intron_variant 
 c.63-44T>C 
  
 Unknown 
 Unknown 
 Unknown 
 GEN157R051 
 synonymous_variant 
 c.312A>G 
 p.Gly104= 
 Unknown 
 Unknown 
 Unknown 
 GEN157R052 
 intron_variant 
 c.413+94C>T 
  
 Unknown 
 Unknown 
 Unknown 
 GEN157R053 
 intron_variant 
 c.413+102A>G 
  
 Unknown 
 Unknown 
 Unknown 
 GEN157R054 
 synonymous_variant 
 c.786C>T 
 p.Arg262= 
 Unknown 
 Unknown 
 Unknown 
 GEN157R055 
 synonymous_variant 
 c.870C>T 
 p.Ala290= 
 Unknown 
 Unknown 
 Unknown 
 GEN157R056 
 synonymous_variant 
 c.978C>T 
 p.Ile326= 
 Unknown 
 Unknown 
 Unknown 
 GEN157R057 
 synonymous_variant 
 c.1071A>G 
 p.Lys357= 
 Unknown 
 Unknown 
 Unknown 
 GEN157R058 
 synonymous_variant 
 c.1371G>A 
 p.Thr457= 
 Unknown 
 Unknown 
 Unknown 
 GEN157R059 
 synonymous_variant 
 c.65T>C 
 p.(=) 
 Unknown 
 Unknown 
 Unknown 
 GEN157R060 
 frameshift_variant 
 c.1200_1222del 
 p.Pro401ArgfsTer8 
 De novo 
  
 Simplex 
 GEN157R061 
 missense_variant 
 c.596C>G 
 p.Pro199Arg 
 Familial 
 Maternal 
 Multiplex 
 GEN157R062 
 stop_gained 
 c.1447G>T 
 p.Glu483Ter 
 Familial 
 Maternal 
 Multiplex 
 GEN157R063 
 missense_variant 
 c.604C>T 
 p.Arg202Cys 
 De novo 
  
 Simplex 
 GEN157R064 
 missense_variant 
 c.398G>T 
 p.Arg133Leu 
 De novo 
  
 Simplex 
 GEN157R065 
 stop_gained 
 c.423C>G 
 p.Tyr141Ter 
 De novo 
  
 Simplex 
 GEN157R066 
 frameshift_variant 
 c.432del 
 p.Arg145AlafsTer6 
 De novo 
  
 Simplex 
 GEN157R067 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 De novo 
  
 Simplex 
 GEN157R068 
 missense_variant 
 c.674C>G 
 p.Pro225Arg 
 De novo 
  
 Simplex 
 GEN157R069 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 De novo 
  
 Simplex 
 GEN157R070 
 stop_gained 
 c.808C>T 
 p.Arg270Ter 
 De novo 
  
 Simplex 
 GEN157R071 
 frameshift_variant 
 c.806del 
 p.Ala269ValfsTer32 
 De novo 
  
 Simplex 
 GEN157R072 
 stop_gained 
 c.880C>T 
 p.Arg294Ter 
 De novo 
  
 Simplex 
 GEN157R073 
 frameshift_variant 
 c.1157del 
 p.Glu386GlyfsTer35 
 De novo 
  
 Simplex 
 GEN157R074 
 frameshift_variant 
 c.1158_1198del 
 p.Glu386AspfsTer5 
 De novo 
  
 Simplex 
 GEN157R075 
 frameshift_variant 
 c.1159del 
 p.Ser387ProfsTer34 
 De novo 
  
 Simplex 
 GEN157R076 
 frameshift_variant 
 c.1165_1233del69ins21 
 p.Pro389_Pro411del23ins7 
 De novo 
  
 Simplex 
 GEN157R077 
 stop_gained 
 c.1357C>T 
 p.Arg453Ter 
 De novo 
  
 Simplex 
 GEN157R078 
 missense_variant 
 c.397C>T 
 p.Arg133Cys 
 De novo 
  
 Simplex 
 GEN157R079 
 stop_gained 
 c.763C>T(c.799C>T) 
 p.Arg255Ter (p.Arg267Ter) 
 De novo 
  
 Simplex 
 GEN157R080 
 missense_variant 
 c.473C>T(c.509C>T) 
 p.Thr158Met (p.Thr170Met) 
 De novo 
  
 Simplex 
 GEN157R081 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 De novo 
  
 Simplex 
 GEN157R082 
 missense_variant 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R083 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 De novo 
  
 Simplex 
 GEN157R084a 
 complex_structural_alteration 
 c.954A>T 
 p.Glu318Asp 
 Familial 
 Maternal 
 Multi-generational 
 GEN157R084b 
 complex_structural_alteration 
 NM_004992.3:c.1097_1235delins50bp 
 p.Arg354_Val412delins41 
 Familial 
 Maternal 
 Multi-generational 
 GEN157R085 
 stop_gained 
 c.1483G>T 
 p.Glu495Ter 
 Familial 
 Maternal 
 Multiplex 
 GEN157R086 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 Unknown 
  
 Unknown 
 GEN157R087 
 missense_variant 
 c.1366G>A 
 p.Ala456Thr 
 Unknown 
  
  
 GEN157R088 
 frameshift_variant 
 c.771_814del 
 p.Met258ProfsTer70 
 De novo 
  
  
 GEN157R089 
 missense_variant 
 c.316C>T 
 p.Arg106Trp 
 De novo 
  
  
 GEN157R090 
 frameshift_variant 
 c.21del 
 p.Ala8ArgfsTer36 
 De novo 
  
  
 GEN157R091 
 missense_variant 
 c.554G>T 
 p.Gly185Val 
 Familial 
 Maternal 
 Multiplex 
 GEN157R092 
 missense_variant 
 c.499C>T 
 p.Arg167Trp 
 Familial 
 Maternal 
 Multiplex 
 GEN157R093 
 missense_variant 
 c.925C>T 
 p.Arg309Trp 
 De novo 
  
  
 GEN157R094 
 missense_variant 
 c.925C>T 
 p.Gln309Ter 
 De novo 
  
  
 GEN157R095 
 missense_variant 
 c.925C>T 
 p.Gln309Ter 
 De novo 
  
  
 GEN157R096 
 missense_variant 
 c.925C>T 
 p.Gln309Ter 
 De novo 
  
  
 GEN157R097 
 missense_variant 
 c.925C>T 
 p.Gln309Ter 
 De novo 
  
  
 GEN157R098 
 missense_variant 
 c.925C>T 
 p.Gln309Ter 
 Familial 
 Maternal 
  
 GEN157R099 
 missense_variant 
 c.419C>T 
 p.Ala140Val 
 Familial 
 Maternal 
 Multiplex 
 GEN157R100 
 stop_gained 
 c.880C>T 
 p.Arg294Ter 
 Unknown 
  
  
 GEN157R101 
 frameshift_variant 
 GGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGT>G 
 p.Pro398fsTer 
 Familial 
 Maternal 
  
 GEN157R102 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
  
 GEN157R103 
 stop_gained 
 c.799C>T 
 p.Arg267Ter 
 De novo 
  
  
 GEN157R104 
 stop_gained 
 c.538C>T 
 p.Arg180Ter 
 Unknown 
 Not maternal 
  
 GEN157R105 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R106 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R107 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 De novo 
  
  
 GEN157R108 
 copy_number_loss 
  
  
 De novo 
  
  
 GEN157R109 
 missense_variant 
 c.397C>T 
 p.Arg133Cys 
 De novo 
  
  
 GEN157R110 
 missense_variant 
 c.915G>T 
 p.Lys305Asn 
 De novo 
  
  
 GEN157R111 
 missense_variant 
 c.491G>T 
 p.Ser164Ile 
 De novo (germline mosaicism) 
  
 Multiplex (dizygotic twins) 
 GEN157R112 
 frameshift_variant 
 c.1164_1207del 
 p.Pro389Ter 
 De novo 
  
 Multiplex 
 GEN157R113 
 frameshift_variant 
 c.722dup 
 p.Pro242AlafsTer6 
 De novo 
  
 Multiplex 
 GEN157R114 
 stop_gained 
 c.1447G>T;c.1483G>T 
 p.Glu483Ter;p.Glu495Ter 
 Familial 
 Maternal 
 Multiplex 
 GEN157R115 
 stop_gained 
 c.800G>A 
 p.Arg267Gln 
 Unknown 
  
 Simplex 
 GEN157R116 
 frameshift_variant 
 c.1167_1200del 
 p.Pro390AlafsTer8 
 Unknown 
  
 Simplex 
 GEN157R117 
 copy_number_gain 
  
  
 Familial 
 Maternal 
  
 GEN157R118 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 De novo 
  
  
 GEN157R119 
 missense_variant 
 c.569G>A 
 p.Arg190His 
 Familial 
  
 Multi-generational 
 GEN157R120 
 missense_variant 
 c.397C>T 
 p.Arg133Cys 
 Familial 
 Maternal 
 Multiplex 
 GEN157R121 
 missense_variant 
 c.916C>T 
 p.Arg306Ter 
 Familial 
 Maternal 
 Multi-generational 
 GEN157R122 
 missense_variant 
 c.397C>T 
 p.Arg133Cys 
 Familial 
 Maternal 
 Multi-generational 
 GEN157R123a 
 stop_gained 
 c.1164_1207del 
 p.Lys389Ter 
 Familial 
 Maternal 
 Simplex 
 GEN157R123b 
 stop_gained 
 c.1227_1229del 
 p.Glu409del 
 Familial 
 Maternal 
 Simplex 
 GEN157R124 
 missense_variant 
 c.1409G>A 
 p.Arg470His 
 Familial 
 Maternal 
 Simplex 
 GEN157R125 
 missense_variant 
 c.441C>G 
 p.Asp147Glu 
 Familial 
 Maternal 
 Multiplex 
 GEN157R126 
 intron_variant 
 c.21C>G 
 p.Ala7= 
 De novo 
  
  
 GEN157R127 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 De novo 
  
  
 GEN157R128 
 frameshift_variant 
 c.1157_1197del 
 p.Glu386AlafsTer5 
 De novo 
  
  
 GEN157R129 
 missense_variant 
 c.455C>T 
 p.Ala152Val 
 De novo 
  
 Simplex 
 GEN157R130 
 missense_variant 
 c.1162C>T 
 p.Pro388Ser 
 Familial 
 Maternal 
 Simplex 
 GEN157R131 
 stop_gained 
 c.880C>T 
 p.Arg294Ter 
 De novo 
  
 Simplex 
 GEN157R132 
 stop_gained 
 c.844C>T 
 p.Arg282Ter 
 De novo 
  
 Simplex 
 GEN157R133 
 copy_number_gain 
  
  
 Familial 
 Maternal 
 Multi-generational 
 GEN157R134 
 copy_number_gain 
  
  
 De novo 
  
  
 GEN157R135 
 missense_variant 
 c.397C>T 
 p.Arg133Cys 
 De novo 
  
  
 GEN157R136 
 frameshift_variant 
 c.1309dup 
 p.Glu437GlyfsTer11 
 De novo 
  
  
 GEN157R137 
 stop_gained 
 c.808C>T 
 p.Arg270Ter 
 De novo 
  
  
 GEN157R138 
 stop_gained 
 c.538C>T 
 p.Arg180Ter 
 De novo 
  
 Simplex 
 GEN157R139 
 stop_gained 
 c.799C>T 
 p.Arg267Ter 
 De novo 
  
 Simplex 
 GEN157R140 
 frameshift_variant 
 c.746del 
 p.Gly249ValfsTer11 
 Familial 
 Maternal 
 Simplex 
 GEN157R141 
 stop_gained 
 c.538C>T 
 p.Arg180Ter 
 Unknown 
 Not maternal 
 Simplex 
 GEN157R142 
 missense_variant 
 c.1108G>A 
 p.Ala370Thr 
 De novo 
  
 Simplex 
 GEN157R143 
 missense_variant 
 c.307C>T 
 p.Arg103Trp 
 De novo 
  
 Simplex 
 GEN157R144 
 frameshift_variant 
 c.1138_1144del 
 p.His380ThrfsTer39 
 Familial 
 Maternal 
 Multiplex 
 GEN157R145 
 frameshift_variant 
 c.806del 
 p.Ala269ValfsTer32 
 De novo 
  
  
 GEN157R146 
 missense_variant 
 c.473C>T 
 p.Thr158Met 
 De novo 
  
 Multi-generational 
 GEN157R147 
 missense_variant 
 c.473C>T 
 p.Thr158Met 
 De novo 
  
  
 GEN157R148 
 copy_number_loss 
  
  
 De novo 
  
  
 GEN157R149 
 missense_variant 
 c.398G>A 
 p.Arg133His 
 De novo 
  
  
 GEN157R150 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
  
 GEN157R151 
 stop_gained 
 c.844C>T 
 p.Arg282Ter 
 De novo 
  
  
 GEN157R152 
 frameshift_variant 
 c.1416_1417del 
 p.Ile473CysfsTer25 
 De novo 
  
  
 GEN157R153 
 missense_variant 
 c.509C>T 
 p.Thr170Met 
 De novo 
  
  
 GEN157R154 
 missense_variant 
 c.473C>T 
 p.Thr158Met 
 De novo 
  
  
 GEN157R155 
 missense_variant 
 c.1208C>G 
 p.Pro403Arg 
 Familial 
 Maternal 
  
 GEN157R156 
 missense_variant 
 c.1216G>A 
 p.Glu406Lys 
 Familial 
 Maternal 
  
 GEN157R157 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 De novo 
  
  
 GEN157R158 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 De novo 
  
  
 GEN157R159 
 frameshift_variant 
 c.47_57del 
 p.Gly16GlufsTer22 
 Unknown 
  
  
 GEN157R160 
 missense_variant 
 c.397C>T 
 p.Arg133Cys 
 De novo 
  
  
 GEN157R161 
 missense_variant 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
  
 GEN157R162 
 missense_variant 
 c.509C>T 
 p.Thr170Met 
 De novo 
  
  
 GEN157R163 
 copy_number_gain 
  
  
 Familial 
 Maternal 
  
 GEN157R164 
 missense_variant 
 c.925C>T 
 p.Gln309Ter 
 De novo 
  
  
 GEN157R165 
 stop_gained 
 c.686C>A 
 p.Pro229His 
 De novo 
  
  
 GEN157R166 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 Unknown 
  
  
 GEN157R167 
 stop_gained 
 c.880C>T 
 p.Arg294Ter 
 De novo 
  
  
 GEN157R168 
 missense_variant 
 c.352C>T 
 p.Arg118Trp 
 Unknown 
  
 Unknown 
 GEN157R169 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 De novo 
  
 Unknown 
 GEN157R170 
 missense_variant 
 c.1104C>G 
 p.Ser368Arg 
 Unknown 
  
 Unknown 
 GEN157R171 
 stop_gained 
 c.538C>T 
 p.Arg180Ter 
 Unknown 
  
 Unknown 
 GEN157R172 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 De novo 
  
 Unknown 
 GEN157R173 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 Unknown 
  
 Unknown 
 GEN157R174 
 missense_variant 
 c.952C>T 
 p.Arg318Cys 
 Unknown 
  
 Unknown 
 GEN157R175 
 frameshift_variant 
 c.1193_1199del 
 p.Leu398HisfsTer21 
 Familial 
 Maternal 
  
 GEN157R176 
 missense_variant 
 c.845A>G 
 p.Glu282Gly 
 De novo 
  
 Simplex 
 GEN157R177 
 missense_variant 
 c.673C>A 
 p.Pro225Thr 
 De novo 
  
  
 GEN157R178 
 missense_variant 
 c.602C>T 
 p.Ala201Val 
 Unknown 
  
  
 GEN157R179 
 missense_variant 
 c.403A>G 
 p.Lys135Glu 
 Unknown 
  
  
 GEN157R180 
 missense_variant 
 c.455C>G 
 p.Pro152Arg 
 Unknown 
  
  
 GEN157R181 
 frameshift_variant 
 c.1157_1185del 
 p.Glu386AlafsTer9 
 Unknown 
  
 Unknown 
 GEN157R182 
 missense_variant 
 c.397C>T 
 p.Arg133Cys 
 Unknown 
  
 Unknown 
 GEN157R183 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 Unknown 
  
 Unknown 
 GEN157R184 
 missense_variant 
 c.439A>G 
 p.Lys147Glu 
 Unknown 
  
 Unknown 
 GEN157R185 
 frameshift_variant 
 c.1158_1164del 
 p.Ser387ArgfsTer32 
 Unknown 
  
 Unknown 
 GEN157R186 
 copy_number_gain 
  
  
 Familial 
 Maternal 
 Unknown 
 GEN157R187 
 stop_gained 
 c.820C>T 
 p.Gln274Ter 
 Unknown 
  
 Unknown 
 GEN157R188 
 stop_gained 
 c.1363G>T 
 p.Ala455Ser 
 Unknown 
  
  
 GEN157R189 
 copy_number_loss 
  
  
 De novo 
  
  
 GEN157R190 
 deletion 
  
  
 De novo 
  
  
 GEN157R191 
 delins 
  
  
 De novo 
  
  
 GEN157R192 
 deletion 
  
  
 De novo 
  
  
 GEN157R193 
 deletion 
  
  
 De novo 
  
  
 GEN157R194 
 frameshift_variant 
 c.1200_1243del 
 p.Pro401Ter 
 De novo 
  
  
 GEN157R195 
 stop_gained 
 c.1198_1239delinsTGAGGACTTGAG 
 p.Pro400_Ser413delinsTer 
 De novo 
  
  
 GEN157R196 
 translocation 
  
  
 De novo 
  
  
 GEN157R197 
 copy_number_gain 
  
  
 Unknown 
  
  
 GEN157R198 
 missense_variant 
 c.467A>G 
 p.Lys156Arg 
 Unknown 
  
  
 GEN157R199 
 missense_variant 
 c.473C>T 
 p.Thr158Met 
 Unknown 
  
  
 GEN157R200 
 missense_variant 
 c.824T>C 
 p.Val275Ala 
 Unknown 
  
  
 GEN157R201 
 5_prime_UTR_variant 
 c.-187_-186del 
  
 Unknown 
  
  
 GEN157R202 
 missense_variant 
 c.674C>G 
 p.Pro225Arg 
 Unknown 
  
  
 GEN157R203 
 missense_variant 
 c.509C>T 
 p.Thr170Met 
 De novo 
  
  
 GEN157R204 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 De novo 
  
  
 GEN157R205 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
  
 GEN157R206 
 missense_variant 
 c.509C>T 
 p.Thr170Met 
 De novo 
  
  
 GEN157R207 
 missense_variant 
 c.473C>T 
 p.Thr158Met 
 De novo 
  
  
 GEN157R208 
 missense_variant 
 c.473C>T 
 p.Thr158Met 
 De novo 
  
  
 GEN157R209 
 frameshift_variant 
 c.59_60del 
 p.Arg20ThrfsTer21 
 De novo 
  
  
 GEN157R210 
 stop_gained 
 c.844C>T 
 p.Arg282Ter 
 De novo 
  
  
 GEN157R211 
 missense_variant 
 c.1208C>G 
 p.Pro403Arg 
 Familial 
 Maternal 
  
 GEN157R212 
 frameshift_variant 
 c.1416_1417del 
 p.Ile473CysfsTer25 
 De novo 
  
  
 GEN157R213 
 missense_variant 
 c.500G>C 
 p.Arg167Pro 
 Unknown 
  
 Multiplex 
 GEN157R214 
 frameshift_variant 
 c.91del 
 p.Gln31ArgfsTer13 
 Unknown 
  
  
 GEN157R215 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 De novo 
  
 Simplex 
 GEN157R216 
 missense_variant 
 c.455C>T 
 p.Ala152Val 
 Familial 
 Maternal 
  
 GEN157R217 
 frameshift_variant 
 c.1164_1198del 
 p.Lys389ThrfsTer4 
 De novo 
  
  
 GEN157R218 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 Unknown 
  
  
 GEN157R219 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
  
 GEN157R220 
 frameshift_variant 
 c.1158_1201del 
 p.Glu386AspfsTer4 
 Unknown 
  
  
 GEN157R221 
 missense_variant 
 c.961C>T 
 p.Arg321Trp 
 De novo 
  
  
 GEN157R222 
 frameshift_variant 
 c.791del 
 p.Gly264AlafsTer37 
 De novo 
  
  
 GEN157R223 
 stop_gained 
 c.799C>T 
 p.Arg267Ter 
 Unknown 
  
  
 GEN157R224 
 missense_variant 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R225 
 missense_variant 
 c.434G>A 
 p.Arg145His 
 De novo 
  
 Simplex 
 GEN157R226 
 missense_variant 
 c.352C>T 
 p.Arg118Trp 
 De novo 
  
 Simplex 
 GEN157R227 
 missense_variant 
 c.710C>G 
 p.Pro237Arg 
 De novo 
  
  
 GEN157R228 
 missense_variant 
 c.686C>T 
 p.Pro229Leu 
 De novo 
  
  
 GEN157R229 
 stop_gained 
 c.427G>T 
 p.Ala143Ser 
 De novo 
  
  
 GEN157R230 
 missense_variant 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R231 
 missense_variant 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R232 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R233 
 stop_gained 
 c.799C>T 
 p.Arg267Ter 
 De novo 
  
 Simplex 
 GEN157R234 
 missense_variant 
 c.710C>G 
 p.Pro237Arg 
 De novo 
  
 Simplex 
 GEN157R235 
 missense_variant 
 c.710C>G 
 p.Pro237Arg 
 De novo 
  
 Simplex 
 GEN157R236 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 De novo 
  
 Simplex 
 GEN157R237 
 frameshift_variant 
 c.1164_1207del 
 p.Lys389Ter 
 De novo 
  
  
 GEN157R238 
 frameshift_variant 
 c.1136_1152del 
 p.His379LeufsTer20 
 De novo 
  
  
 GEN157R239 
 missense_variant 
 c.925C>T 
 p.Gln309Ter 
 De novo 
  
  
 GEN157R240 
 missense_variant 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
  
 GEN157R241 
 missense_variant 
 c.851C>T 
 p.Pro284Leu 
 De novo 
  
  
 GEN157R242 
 missense_variant 
 c.508A>G 
 p.Thr170Ala 
 De novo 
  
  
 GEN157R243 
 missense_variant 
 c.437C>G 
 p.Ser146Cys 
 De novo 
  
  
 GEN157R244 
 missense_variant 
 c.352C>T 
 p.Arg118Trp 
 De novo 
  
  
 GEN157R245 
 missense_variant 
 c.215G>A 
 p.Gly72Asp 
 De novo 
  
  
 GEN157R246 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R247 
 missense_variant 
 c.710C>G 
 p.Pro237Arg 
 De novo 
  
  
 GEN157R248 
 missense_variant 
 c.941C>G 
 p.Pro314Arg 
 De novo 
  
 Simplex 
 GEN157R249 
 missense_variant 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R250 
 frameshift_variant 
 c.1164_1207del 
 p.Lys389Ter 
 De novo 
  
  
 GEN157R251 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
  
 GEN157R252 
 missense_variant 
 c.509C>T 
 p.Thr170Met 
 De novo 
  
  
 GEN157R253 
 missense_variant 
 c.917G>A 
 p.Arg306Gln 
 De novo 
  
  
 GEN157R254 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
  
 GEN157R255 
 missense_variant 
 c.710C>G 
 p.Pro237Arg 
 De novo 
  
 Simplex 
 GEN157R256 
 missense_variant 
 c.952C>T 
 p.Arg318Cys 
 De novo 
  
 Simplex 
 GEN157R257 
 stop_gained 
 c.844C>T 
 p.Arg282Ter 
 De novo 
  
 Simplex 
 GEN157R258 
 missense_variant 
 c.952C>T 
 p.Arg318Cys 
 De novo 
  
 Simplex 
 GEN157R259 
 frameshift_variant 
 c.1122del 
 p.Lys375ArgfsTer46 
 Familial 
 Maternal 
 Multiplex 
 GEN157R260 
 frameshift_variant 
 c.23_27del 
 p.Ala8GlufsTer32 
 De novo 
  
 Simplex 
 GEN157R261 
 frameshift_variant 
 c.842dup 
 p.Arg282ProfsTer61 
 De novo 
  
 Simplex 
 GEN157R262 
 missense_variant 
 c.491C>G 
 p.Pro164Arg 
 De novo 
  
 Simplex 
 GEN157R263 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 De novo 
  
 Simplex 
 GEN157R264 
 stop_gained 
 c.538C>T 
 p.Arg180Ter 
 De novo 
  
 Simplex 
 GEN157R265 
 missense_variant 
 c.952C>T 
 p.Arg318Cys 
 De novo 
  
 Simplex 
 GEN157R266 
 missense_variant 
 c.910C>T 
 p.Leu313Phe 
 Unknown 
  
  
 GEN157R267 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R268 
 missense_variant 
 c.455C>T 
 p.Ala152Val 
 Unknown 
  
 Simplex 
 GEN157R269 
 frameshift_variant 
 c.148_152del 
 p.Glu50ArgfsTer5 
 Unknown 
  
 Simplex 
 GEN157R270 
 missense_variant 
 c.1376C>T 
 p.Ala459Val 
 Unknown 
  
 Simplex 
 GEN157R271 
 missense_variant 
 c.1030C>T 
 p.Arg344Trp 
 Unknown 
 Not maternal 
  
 GEN157R272 
 stop_gained 
 c.844C>T 
 p.Arg282Ter 
 De novo 
  
 Simplex 
 GEN157R273 
 missense_variant 
 c.509C>T 
 p.Thr170Met 
 Unknown 
  
 Simplex 
 GEN157R274 
 frameshift_variant 
 c.1197_1222delinsAGC 
 p.Pro400AlafsTer9 
 Unknown 
  
  
 GEN157R275 
 frameshift_variant 
 c.1233dup 
 p.Thr412HisfsTer5 
 Unknown 
  
  
 GEN157R276 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 Unknown 
  
  
 GEN157R277 
 missense_variant 
 c.724C>A 
 p.Pro242Thr 
 Familial 
 Maternal 
  
 GEN157R278 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 De novo 
  
  
 GEN157R279 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 De novo 
  
  
 GEN157R280 
 frameshift_variant 
 c.792_795del 
 p.Arg265SerfsTer35 
 De novo 
  
  
 GEN157R281 
 copy_number_loss 
  
  
 Unknown 
  
  
 GEN157R282 
 frameshift_variant 
 c.842del 
 p.Gly281AlafsTer20 
 De novo 
  
  
 GEN157R283 
 frameshift_variant 
 c.1200_1243del 
 p.Pro401Ter 
 Unknown 
  
  
 GEN157R284 
 missense_variant 
 c.916C>T 
 p.Arg306Ter 
 Unknown 
  
  
 GEN157R285 
 missense_variant 
 c.952C>T 
 p.Arg318Cys 
 Unknown 
  
  
 GEN157R286 
 splice_region_variant 
 c.378-3C>G 
 p.? 
 Unknown 
  
  
 GEN157R287 
 stop_gained 
 c.799C>T 
 p.Arg267Ter 
 Unknown 
  
  
 GEN157R288 
 missense_variant 
 c.509C>T 
 p.Thr170Met 
 Unknown 
  
  
 GEN157R289 
 missense_variant 
 c.1922A>T 
 p.Asp641Val 
 Unknown 
  
  
 GEN157R290 
 missense_variant 
 c.491C>G 
 p.Pro164Arg 
 Unknown 
  
  
 GEN157R291 
 frameshift_variant 
 c.1265dup 
 p.Ser422ArgfsTer26 
 De novo 
  
 Simplex 
 GEN157R292 
 frameshift_variant 
 c.281_284dup 
 p.Arg96ThrfsTer8 
 De novo 
  
 Simplex 
 GEN157R293 
 missense_variant 
 c.952C>T 
 p.Arg318Cys 
 De novo 
  
 Simplex 
 GEN157R294 
 stop_gained 
 c.844C>T 
 p.Arg282Ter 
 De novo 
  
 Simplex 
 GEN157R295a 
 inversion 
  
  
 Familial 
 Maternal 
 Simplex 
 GEN157R295b 
 copy_number_loss 
  
  
 Familial 
 Maternal 
 Simplex 
 GEN157R295c 
 copy_number_gain 
  
  
 Familial 
 Maternal 
 Simplex 
 GEN157R296 
 inversion 
  
  
 De novo 
  
 Simplex 
 GEN157R297 
 missense_variant 
 c.397C>T 
 p.Arg133Cys 
 Unknown 
  
  
 GEN157R298 
 stop_gained 
 c.808C>T 
 p.Arg270Ter 
 De novo 
  
  
 GEN157R299 
 stop_gained 
 c.880C>T 
 p.Arg294Ter 
 De novo 
  
  
 GEN157R300 
 frameshift_variant 
 c.1152_1155del 
 p.His384GlnfsTer36 
 Unknown 
  
  
 GEN157R301 
 frameshift_variant 
 c.1152_1155del 
 p.His384GlnfsTer36 
 Unknown 
  
  
 GEN157R302 
 missense_variant 
 c.316C>T 
 p.Arg106Trp 
 De novo 
  
  
 GEN157R303 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 De novo 
  
  
 GEN157R304 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 Unknown 
  
  
 GEN157R305 
 splice_site_variant 
 c.26+2T>G 
  
 Unknown 
  
  
 GEN157R306 
 stop_gained 
 c.1164_1207del 
 p.Pro389Ter 
 Unknown 
  
  
 GEN157R307 
 missense_variant 
 c.419C>T 
 p.Ala140Val 
 Unknown 
  
  
 GEN157R308 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 De novo 
  
  
 GEN157R309 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 De novo 
  
  
 GEN157R310 
 missense_variant 
 c.473C>T 
 p.Thr158Met 
 De novo 
  
  
 GEN157R311 
 stop_gained 
 c.880C>T 
 p.Arg294Ter 
 De novo 
  
  
 GEN157R312 
 stop_gained 
 c.808C>T 
 p.Arg270Ter 
 De novo 
  
  
 GEN157R313 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 De novo 
  
  
 GEN157R314 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 De novo 
  
  
 GEN157R315 
 frameshift_variant 
 c.1080_1194delins60 
 p.Pro362fs 
 De novo 
  
  
 GEN157R316 
 missense_variant 
 c.140C>T 
 p.Ala47Val 
 Unknown 
  
  
 GEN157R317 
 missense_variant 
 c.194C>T 
 p.Thr65Met 
 Unknown 
  
  
 GEN157R318 
 missense_variant 
 c.25C>G 
 p.Pro9Ala 
 Unknown 
  
  
 GEN157R319 
 stop_gained 
 c.223C>T 
 p.Arg75Ter 
 Unknown 
  
  
 GEN157R320 
 missense_variant 
 c.517A>G 
 p.Lys173Glu 
 Unknown 
  
  
 GEN157R321 
 stop_gained 
 c.529C>T 
 p.Arg177Ter 
 Unknown 
  
  
 GEN157R322 
 missense_variant 
 c.710C>G 
 p.Pro237Arg 
 De novo 
  
 Simplex 
 GEN157R323 
 missense_variant 
 c.504C>G 
 p.Asp168Glu 
 De novo 
  
 Simplex 
 GEN157R324 
 frameshift_variant 
 c.1225_1226del 
 p.Ser409GlnfsTer26 
 De novo 
  
 Simplex 
 GEN157R325 
 stop_gained 
 c.538C>T 
 p.Arg180Ter 
 De novo 
  
 Simplex 
 GEN157R326 
 missense_variant 
 c.952C>T 
 p.Arg318Cys 
 De novo 
  
 Simplex 
 GEN157R327 
 missense_variant 
 c.1409G>A 
 p.Arg470His 
 Familial 
 Maternal 
 Simplex 
 GEN157R328 
 missense_variant 
 c.1160C>T 
 p.Pro387Leu 
 Familial 
 Maternal 
  
 GEN157R329 
 stop_gained 
 c.808C>T 
 p.Arg270Ter 
 Unknown 
  
  
 GEN157R330 
 missense_variant 
 c.509C>T 
 p.Thr170Met 
 De novo 
  
  
 GEN157R331 
 stop_gained 
 c.538C>T 
 p.Arg180Ter 
 Unknown 
  
  
 GEN157R332 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 Unknown 
  
  
 GEN157R333 
 stop_gained 
 c.538C>T 
 p.Arg180Ter 
 Unknown 
  
  
 GEN157R334 
 stop_gained 
 c.808C>T 
 p.Arg270Ter 
 De novo 
  
 Simplex 
 GEN157R335 
 stop_gained 
 c.808C>T 
 p.Arg270Ter 
 Unknown 
  
 Simplex 
 GEN157R336 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 Unknown 
  
 Simplex 
 GEN157R337 
 missense_variant 
 c.473C>T 
 p.Thr158Met 
 Unknown 
  
 Simplex 
 GEN157R338 
 missense_variant 
 c.316C>T 
 p.Arg106Trp 
 Unknown 
  
 Simplex 
 GEN157R339 
 missense_variant 
 c.1231A>G 
 p.Ser411Gly 
 Familial 
 Maternal 
 Unknown 
 GEN157R340 
 stop_gained 
 c.1208dup 
 p.Glu404Ter 
 Familial 
 Maternal 
  
 GEN157R341 
 missense_variant 
 c.509C>T 
 p.Thr170Met 
 De novo 
  
  
 GEN157R342 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 De novo 
  
  
 GEN157R343 
 missense_variant 
 c.434G>C 
 p.Arg145Pro 
 De novo 
  
 Simplex 
 GEN157R344 
 stop_gained 
 c.538C>T 
 p.Arg180Ter 
 De novo 
  
  
 GEN157R345 
 missense_variant 
 c.908C>G 
 p.Ser303Cys 
 Unknown 
  
  
 GEN157R346 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 De novo 
  
 Simplex 
 GEN157R347 
 stop_lost 
 c.1081_*457del 
  
 De novo 
  
 Simplex 
 GEN157R348 
 missense_variant 
 c.952C>T 
 p.Arg318Cys 
 De novo 
  
 Simplex 
 GEN157R349 
 missense_variant 
 c.1271T>C 
 p.Val424Ala 
 Familial 
 Maternal 
 Simplex 
 GEN157R350 
 frameshift_variant 
 c.1174_1192del 
 p.Val392CysfsTer23 
 Unknown 
  
  
 GEN157R351 
 missense_variant 
 c.524G>A 
 p.Gly175Glu 
 De novo 
  
 Simplex 
 GEN157R352 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R353 
 frameshift_variant 
 c.44_45insCGAGG 
 p.Gly16GlufsTer30 
 De novo 
  
 Simplex 

Common

No Common Variants Available
Chromosome
CNV Locus
CNV Type
# of studies
Animal Model
X
Deletion
 1
 
X
Duplication
 1
 
X
Deletion-Duplication
 22
 
X
Deletion
 2
 
X
Deletion
 1
 
X
Deletion
 2
 
X
Deletion-Duplication
 1
 
X
Deletion
 2
 
X
Deletion-Duplication
 1
 
X
Deletion
 12
 
X
Deletion-Duplication
 83
 

Model Summary

Mecp2 deficiency is sufficient to cause neuronal dysfunction with symptomatic manifestation similar to Rett syndrome.

References

Type
Title
Author, Year
Primary
Degraded neural and behavioral processing of speech sounds in a rat model of Rett syndrome.
Additional
Characterization of Rett Syndrome-like phenotypes in Mecp2-knockout rats.
Additional
MeCP2 deficiency results in robust Rett-like behavioural and motor deficits in male and female rats.
Additional
Loss of MeCP2 in the rat models regression, impaired sociability and transcriptional deficits of Rett syndrome.
Additional
Neuronal cytoskeletal gene dysregulation and mechanical hypersensitivity in a rat model of Rett syndrome.
Additional
Motor, Somatosensory, Viscerosensory and Metabolic Impairments in a Heterozygous Female Rat Model of Rett Syndrome.

R_MECP2_1_KO_HT

Model Type: Genetic
Model Genotype: Heterozygous
Mutation: 71 base pair deletion in Exon 4.
Allele Type: Knockout
Strain of Origin: Not Specified
Genetic Background: Sprague Dawley
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: SAGE labs

R_MECP2_2_KO_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: 71 base pair deletion in Exon 4.
Allele Type: Knockout
Strain of Origin: Not Specified
Genetic Background: Sprague Dawley
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: SAGE labs

R_MECP2_3_KD

Model Type: Genetic
Model Genotype: Wild type
Mutation: Mecp2 shRNA was delivered via lentivirus vector injected into the footpad of wild-type male pup at P7.
Allele Type: Knockdown
Strain of Origin: Not Specified
Genetic Background: Not Specified
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

R_MECP2_1_KO_HT

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Locomotor activity in diurnal cycle: light phase4
Decreased
Description: Heterozygous females showed a moderate decline of diurnal activity compared to wildtype.
Exp Paradigm: Measurement of ambulatory behavior over a 24-hour period
 Beam crossing
 4 months
Gait2
Abnormal
Description: Mecp2 -/+ rats displayed significant deviations from wild-type motor patterns at various time points, with relatively clear trends toward alterations throughout development. Mecp2-/+ crossing speed was decreased and number of steps increased at both 6 and 9 months of age. Usage of 3-paw support during movement was decreased in Mecp2 -/+ rats at one week post-weaning as well as 12 and 15 months of age. The base of support, or width of stance, between hind paws was found to be increased in Mecp2 -/+ rats beginning at 6 months of age and continuing through 15 months of age.
Exp Paradigm: Footprint analysis: Catwalk testing
 Footprint analysis
 1-18 months
Limb posture4
Abnormal
Description: Heterozygous females showed an increase in hind limb stance width, reflecting postural deficits
Exp Paradigm: Measurement of hind paw stance width
 General observations
 4 months
Gait4
Abnormal
Description: Heterozygous females showed abnormal gait measured by the step cycle of the forepaws: brake and swing times were increased, and the propel phase was decreased compared to wildtype. The hind paw step cycle did not show statistically significant differences.
Exp Paradigm: Measurement of DigiGait parameters: brake is the interval from first contact with surface to peak stance, propel is the phase from peak until end of contact, swing is the transitional phase in which the paw is not in contact and extends forward.
 Gait
 4 months
Motor coordination and balance2
Decreased
Description: Mecp2 -/+ females also demonstrated a decreased latency to fall at 9 months of age compared to wild-type littermate controls.
Exp Paradigm: Footprint analysis
 Footprint analysis
 1-9 months
General locomotor activity2
Decreased
Description: Mecp2 -/+ rats displayed a trend toward a decrease in distance travelled, average velocity, and time spent highly mobile, with these parameters showing genotype-specific statistical significance at only one or two time points between the age of weaning and 15 months.
Exp Paradigm: Open field test
 Open field test
 1-15 months
Ataxia4
Increased
Description: Heterozygous females showed forepaw ataxia, measured by the ataxia coefficient (p=0.038)
Exp Paradigm: Measurement of ataxia coefficient: maximum stride length minus minimum stride length.
 General observations
 4 months
Motor coordination and balance4
Decreased
Description: Heterozygous females showed significant declines in motor coordination starting at 6 weeks, measured by a decreased latency to fall from rotarod during a progressively increasing rate of rotation.
Exp Paradigm: Measurement of latency to fall.
 Accelerating rotarod test
 6-22 weeks
General locomotor activity3
Decreased
Description: Decreased distance travelled
Exp Paradigm: Open field test
 Open field test
 Unreported
Limb posture2
Abnormal
Description: Hindlimb clasping, which is considered an identifying characteristic of symptomatic RTT mice, was observed in approximately 70% of Mecp2 -/+ rats by 9 months of age
Exp Paradigm: General observations
 General observations
 1-9 months
Brain size2
Decreased
Description: The brains of Mecp2 -/+ rats weighed significantly less than that of wild-type littermate females beginning at P21.
Exp Paradigm: Measurement of tissue weight
 Measurement of tissue weight
 2-12 weeks
Synaptic transmission: excitatory1
Decreased
Description: Decreased amplitude and increased time
Exp Paradigm: In vivo local field potential (LFP) recordings, females
 In vivo local field potential (lfp) recordings
 Unreported
Sensory-evoked response: excitation: auditory stimulus1
Decreased
Description: Decreased discrimination of sounds
Exp Paradigm: Application of auditory stimuli, females
 Application of auditory stimuli
 Unreported
Pain or nociception: thermal: cold4
Increased
Description: A general tendency toward higher sensitivity to noxious cold was observed at 4 and 6 weeks, and differences became prominent from 8 weeks through 22 weeks.
Exp Paradigm: Cold sensitivity was measured using a Cold Plate Analgesia Meter. The average temperature at which nociceptive behaviors were seen is reported as the withdrawal threshold.
 Cold plate analgesia meter
 4-22 weeks
Pain or nociception: mechanical4
Increased
Description: Thresholds rose for wildtype rats at 8 weeks as part of typical developmental course, but heterozygote rats remained hypersensitive throughout the adult life through 22 weeks.
Exp Paradigm: Von Frey filament applied to hind foot paw to determine threshold of withdrawal response.
 Von frey filament test
 2-5 months
Juvenile play3
Decreased
Description: Decreased contact, pounce and wrestling behaviors
Exp Paradigm: Reciprocal social interaction test
 Reciprocal social interaction test
 4 weeks
Social approach3
Decreased
Description: Decreased preference for stimulus rat
Exp Paradigm: Three-chamber social approach test
 Three-chamber social approach test
 4 weeks
Satiety response4
Increased
Description: Heterozygote rats ate substantially less food compared to wildtype, both at night time and daytime.
 Food intake measurements
 4 months
Homeostasis: adiposity4
Increased
Description: Total body fat was elevated approximately three-fold in the heterozygote rats relative to the wildtype rats.
 Magnetic resonance imaging (mri)
 4 months
Satiety response4
Decreased
Description: Daytime drinking in heterozygote rats was similar to wildtype; however, they drank approximately twice as much water at night relative to wildtype rats.
 Water intake measurements
 4 months
Digestive system function: gastrointestinal motility: peristaltic reflexes4
Decreased
Description: In response to applied colorectal pressures from 20 to 80 mm Hg, the visceromotor response increased in both wildtype and heterozygote rats. However, the heterozygous animals showed reduced visceromotor response relative to wildtype rats at pressures from 40 to 80 mm Hg, consistent with visceral hyposensitivity.
Exp Paradigm: Electromyographic recordings of visceromotor response in abdominal muscles, as a result from colorectal distension.
 Electromyogram (emg)
 4 months
Respiratory function2
Increased
Description: Aged Mecp2 -/+ females show an enhanced respiratory frequency in conjunction with reduced expiratory time.
Exp Paradigm: Whole body plethysmography
 Whole body plethysmography
 18 months
Metabolic function4
Decreased
Description: Heterozygote rats showed consistently lower metabolic values, with a significanly lower respiratory quotient detected during the light phase of the diurnal cycle.
Exp Paradigm: Metabolic indices measured by calorimetry during light and dark phases over a 48-h test period in wildtype and heterozygous rats.
 Energy homeostasis analysis
 4 months
Size/growth2
Increased
Description: Mecp2 -/+ rats displayed a tendency for weight gain, becoming significantly heavier than WTs by P60-P90.
Exp Paradigm: Body weight measurement, females
 Body weight measurement
 2-18 months
Size/growth4
Increased
Description: Beginning at eight weeks of age heterozygote rats were heavier than wildtype, and the difference increased with time throughout the 22 weeks of the study.
 Body weight measurement
 2-5 months
Anxiety3
Decreased
Description: Increased time spent in open area
Exp Paradigm: Elevated zero maze test
 Elevated zero maze test
 3 weeks
Cued or contextual fear conditioning: memory of context3
Increased
Description: Increased freezing response
Exp Paradigm: Fear conditioning test
 Fear conditioning test
 5 weeks
Targeted expression3
Decreased
Description: An approximate 50% reduction in MeCP2 levels in female rats lacking one copy of Mecp2.
Exp Paradigm: Western blot
 Western blot
 Unreported
Targeted expression2
Decreased
Description: Reduced levels of MECP2 protein in heterozygous females
Exp Paradigm: Western blot from cortex and brain stem of P60-80 males, and cortex of 15-week old females
 Western blot
 2-3 months, 15 months
Locomotor activity in diurnal cycle: dark phase4
 No change
 Beam crossing
 4 months
Mortality/lethality2
 No change
 Survival analysis
 0-12 weeks
Size/growth4
 No change
 Body weight measurement
 4-6 weeks
Cued or contextual fear conditioning: memory of cue3
 No change
 Fear conditioning test
 5 weeks
Motor coordination and balance4
 No change
 Accelerating rotarod test
 4 weeks
Stereotypy3
 No change
 General observations
 6 weeks
Olfaction3
 No change
 Olfactory discrimination test
 6 weeks
Pain or nociception: mechanical4
 No change
 Von frey filament test
 4-6 weeks
Pain or nociception: thermal4
 No change
 Paw withdrawal test
 4-22 weeks
Sensorimotor gating3
 No change
 Prepulse inhibition
 5 weeks
Startle response: acoustic stimulus3
 No change
 Acoustic startle reflex test
 5 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Motor phenotype, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

R_MECP2_2_KO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Grip strength1
Decreased
Description: The Mecp2 -/y rats showed a significant decrease in muscle strength starting in 4 weeks after birth, and remained significantly lower thereafter than that of the WT.
Exp Paradigm: The rat was lifted by the tail, and its forelimbs were allowed to grasp the metal mesh fixed to a force-electricity transducer. The rat was then gently pulled upward while it grasped the mesh (10 mm 10 mm) with both forelimbs. The maximal force reached immediately before it released the mesh was taken as the grip strength.
 Grip strength test
 4-9 weeks
General locomotor activity1
Decreased
Description: Mecp2 -/y rats showed 43 % reduction in locomotor activity
Exp Paradigm: A rat was placed in the center of an enclosure and allowed to ex- plore around for 10 min. The number of the squares crossed by the rat was counted and recorded as locomo- tion activity (squares crossed per min).
 Open field test
 4-5 weeks
Motor coordination and balance2
Decreased
Description: A significant decrease in latency to fall in Mecp2 -/y rats was observed relative to wild-type littermates at both early (3-4 weeks) and late (adult) developmental time points.
Exp Paradigm: Footprint analysis
 Footprint analysis
 3-6 weeks
General locomotor activity2
Decreased
Description: Mecp2 -/y males displayed a decrease in overall distance travelled, average velocity, and percent of total time spent highly mobile when compared to wild-type littermates.
Exp Paradigm: Open field test
 Open field test
 3-6 weeks
Limb posture2
Abnormal
Description: Hindlimb clasping, which is considered an identifying characteristic of symptomatic RTT mice, was observed in approximately 70% of Mecp2 -/y by P50.
Exp Paradigm: General observations
 General observations
 3-9 weeks
Gait2
Abnormal
Description: Mecp2 -/y rats displayed a decreased incidence of gait involving the simultaneous contact of 3 paws at both early (3-4 weels) and late (adu't) time points. Additionally, right hindlimb swing speed was decreased in Mecp2 -/y rats beginning at 3-4 weeks, and both right front and hindlimb swing speed and stride length were decreased in the adult. Despite these observed differences between Mecp2 -/y and WT males, there was no significant genotype-specific alteration in the regularity index, a measure of the normality of footfall patterns, at either time point evaluated.
Exp Paradigm: Footprint analysis: Catwalk testing
 Footprint analysis
 3-6 weeks
Anatomical projections and connectivity4
Increased
Description: Cutaneous targets are hyperinnervated in Mecp2 KO rats. More specifically, there was an increase in non-peptidergic axons.
Exp Paradigm: Immunohistochemistry
 Immunohistochemistry
 Unreported
Brain size2
Decreased
Description: Evaluation of wet brain weights revealed that Mecp2 -/y brains weighed significantly less than their WT littermates as early as P14.
Exp Paradigm: Measurement of tissue weight
 Measurement of tissue weight
 2-12 weeks
Anatomical projections and connectivity4
Decreased
Description: Reduced number of peptidergic axons.
Exp Paradigm: Immunohistochemistry
 Immunohistochemistry
 Unreported
Network excitability1
Increased
Description: The firing rate of LC (locus coeruleus) neurons in Mecp2/Y rats was increased by 54.0 14.6 % over the WT level.
Exp Paradigm: Whole-cell current clamp was performed on LC neurons in the brain slices.
 Whole-cell patch clamp
 4-6 weeks
Action potential firing1
Increased
Description: In Mecp2 -/y rats, the threshold of action potential was shifted to significantly more hyperpolarizing potentials
Exp Paradigm: Whole-cell current clamp was performed on LC neurons in the brain slices.
 Whole-cell patch clamp
 4-6 weeks
Pain or nociception: mechanical4
Increased
Description: Smaller force threshold for paw withdrawal.
Exp Paradigm: Following acclimation, six monofilaments, ranging from 2 to 15 g, were applied five times to each hind paw at intervals of not less than 2 min. The number of positive responses, as observed by lifting or biting of the hind paw, was recorded. The calibrated force of the monofilament generating a 50% withdrawal response rate was recorded as the withdrawal threshold.
 Von frey filament test
 4-7 weeks
Pain or nociception: thermal: cold4
Increased
Description: Warmer threshold for paw withdrawal.
Exp Paradigm: Cold sensitivity was measured using a Cold Plate Analgesia Meter. The average temperature at which nociceptive behaviors were seen is reported as the withdrawal threshold.
 Cold plate analgesia meter
 4-7 weeks
Pain or nociception: thermal4
Decreased
Description: Increased latency to paw withdrawal.
Exp Paradigm: Thermal sensitivity was measured as withdrawal latency to a fixed 4.85-A source directed to the paw. Thermal withdrawal latencies of each hind paw were measured in triplicate, with a minimum of 3 min between trials, and were averaged.
 Paw withdrawal test
 4-7 weeks
Social approach1
Decreased
Description: WT rodents spent more time with their conspecifics than the empty chamber, but such a preference was not seen in both Mecp2 -/y rodents.
Exp Paradigm: Sociability was tested, in which a male intruder (Animal 1) in one mesh bucket was introduced to one of the side chambers randomly, while the other bucket was kept empty. The test animal was allowed to explore both the chambers for 10 min with the total time spent in the chamber measured.
 Three-chamber social approach test
 4-5 weeks
Social memory1
Decreased
Description: WT animals showed a clear tendency of social novelty by spending a longer time with the stranger animal than with the familiar one, but such a preference disappeared in Mecp2 -/y animals.
Exp Paradigm: Social novelty was tested by switching the familiar intruder into the other chamber and introducing a novel male intruder (Animal 2) to the chamber. The tested animal was monitored for 10 min as well. The time spent in each side chamber was measured.
 Three-chamber social approach test
 4-5 weeks
Respiratory function2
Decreased
Description: Juvenile Mecp2 -/y rats (3-4 weeks) breathed at a reduced rate compared to wild-type littermates. The reduction in frequency was due to both an increase in inspiratory time and expiratory time. Juvenile Mecp2 -/y males exhibit an otherwise normal tidal volume, minute ventilation, a relatively stable respiratory cycle, and a similar number of spontaneous apneas, but of a shorter duration compared to controls. Adult hemizygous male rats exhibited a similar phenotype to juvenile rats, hypoventilation and reduced apnea duration.
Exp Paradigm: Whole body plethysmography
 Whole body plethysmography
 3-6 weeks
Respiratory function1
Abnormal
Description: High apnea rate and breathing frequency variations
Exp Paradigm: Breathing activities of awake rats were recorded with a ~1100-ml plethysmograph chamber. The individual animal was kept in the plethysmograph chamber with air ventilation at a rate of ~1000 ml/min. After at least 20 min adaptation, breathing activity was recorded continuously for 20 min as the barometrical changes between the plethysmograph chamber and the reference chamber with a force-electricity transducer.
 Whole body plethysmography
 4-12 weeks
Homeostasis1
Abnormal
Description: Observed with porphyrin (red tear), which was not seen the WT littermates, and usually indicated sickness and stress
Exp Paradigm: General observations
 General observations
 Unreported
Reproductive system development2
Abnormal
Description: Mecp2 -/y males occasionally exhibited retracted testes as early as P21, and the appearance of a shrivelled scrotum often continued throughout adulthood.
Exp Paradigm: General observations
 General observations
 3-6 weeks
Size/growth1
Decreased
Description: Smaller body size and lower body weight, no significant differences 1-3 weeks
Exp Paradigm: Body length measurement
 Body length measurement
 4-9 weeks
Mortality/lethality2
Increased
Description: Approximately half of all Mecp2-/y males died by P55
Exp Paradigm: Survival analysis
 Survival analysis
 0-12 weeks
Skeletal development: craniofacial1
Abnormal
Description: Malocclusion (overgrowth of incisor teeth and mis- placed midline)
Exp Paradigm: General observations
 General observations
 Unreported
Size/growth2
Abnormal
Description: Body weights of Mecp2 -/y rats that did not develop malocclusion by P50 did not differ significantly from WTs at any of the developmental time points examined. Many Mecp2 -/y rats that went on to develop malocclusion were generally smaller than their WT counterparts starting early in development, before tooth lengthening.
Exp Paradigm: Body weight measurement, males
 Body weight measurement
 3-6 weeks
Mortality/lethality1
Increased
Description: All Mecp2 -/y rats died between P45 and P82, while none of the WT rats died in that time-frame.
Exp Paradigm: WT and Mecp2/Y animals were randomly selected from litters. Their lifespan were monitored. Death date of each group was recorded. A total of 18 WT males and 18 Mecp2/Y rats were used in the studies, and two outliers (the longest and shortest survivors) were removed.
 Survival analysis
 P0-P125
Skeletal development: craniofacial2
Abnormal
Description: Development of dental malocclusion in approximately 80% of Mecp2 -/y rats by P50
Exp Paradigm: General observations
 General observations
 3-6 weeks
Reproductive system development1
Abnormal
Description: Prolapsed penis
Exp Paradigm: General observations
 General observations
 Unreported
Size/growth1
Decreased
Description: Smaller body size and lower body weight, no significant differences 1-3 weeks
Exp Paradigm: Body weight measurement
 Body weight measurement
 4-9 weeks
Gene expression3
Decreased
Description: 1,268 significantly altered gene expression changes. The magnitude of fold changes were not dramatic. Hemizygous rats have approximate equal balance of alterations (638 down-regulated versus 630 up-regulated genes).
Exp Paradigm: RNA sequencing
 Rna sequencing
 Unreported
Targeted expression2
Decreased
Description: Total absence of MECP2 protein in hemizygous males
Exp Paradigm: Western blot from cortex and brain stem of P60-80 males, and cortex of 15-week old females
 Western blot
 2-3 months, 15 months
Targeted expression3
Decreased
Description: Complete loss of full-length MeCP2 protein in hemizygote male rats lacking Mecp2.
Exp Paradigm: Western blot
 Western blot
 Unreported
Gene expression4
Abnormal
Description: Differential expression of a wide range of genes.
Exp Paradigm: Whole-transcriptome sequencing of RNA isolated from KO and WT DRGs.
 Rna sequencing
 Unreported
Exploratory activity: habituation1
 No change
 Three-chamber social approach test
 4-5 weeks
Limb posture1
 No change
 General observations
 Unreported
Action potential properties: amplitude, rate of depolarization and repolarization1
 No change
 Whole-cell patch clamp
 4-6 weeks
Intrinsic membrane properties1
 No change
 Whole-cell patch clamp
 4-6 weeks
Membrane potential1
 No change
 Whole-cell patch clamp
 4-6 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Motor phenotype, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

R_MECP2_3_KD

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Anatomical projections and connectivity1
Increased
Description: Mecp2 knockdown paws had greater numbers of sub- and intraepithelial nerve fibers. Innervation density is a result of non-peptidergic fiber proliferation.
Exp Paradigm: Immunohistochemistry
 Immunohistochemistry
 Unreported
Pain or nociception: mechanical1
Increased
Description: Smaller force threshold for paw withdrawal.
Exp Paradigm: Following acclimation, six monofilaments, ranging from 2 to 15 g, were applied five times to each hind paw at intervals of not less than 2 min. The number of positive responses, as observed by lifting or biting of the hind paw, was recorded. The calibrated force of the monofilament generating a 50% withdrawal response rate was recorded as the withdrawal threshold.
 Von frey filament test
 4-7 weeks
Anatomical projections and connectivity1
 No change
 Immunohistochemistry
 Unreported
Pain or nociception: thermal1
 No change
 Paw withdrawal test
 4-7 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Motor phenotype, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Social behavior


Interactor Symbol Interactor Name Interactor Organism Entrez ID Uniprot ID Interaction Type Evidence Reference
7-Sep septin 7 989 A8K3D0 ChIP
Ballestar E , et al. 2004
ABCB1 ATP-binding cassette, sub-family B (MDR/TAP), member 1 5243 A4D1D2 ChIP
El-Osta A and Wolffe AP 2001
ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 9429 Q9UNQ0 ChIP
To KK , et al. 2006
ACTL6A actin-like 6A 86 O96019 IP; LC-MS/MS
Tsujimura K , et al. 2015
ADAM12 ADAM metallopeptidase domain 12 8038 O43184 Supershift assay; ChIP
Ray BK , et al. 2012
ADORA2A adenosine A2a receptor 135 P29274 ChIP
Buira SP , et al. 2009
ANKRD2 ankyrin repeat domain 2 (stretch responsive muscle) 26287 Q9GZV1 Protein microarray; GST; DNA affinity precipitation
Belgrano A , et al. 2011
APOE apolipoprotein E 348 P02649 ChIP
Ballestar E , et al. 2003
Arx aristaless related homeobox 170302 Q96QS3 ChIP
Dhawan S , et al. 2011
BAZ1A bromodomain adjacent to zinc finger domain, 1A 11177 Q9NRL2 IP; LC-MS/MS
Huttlin EL , et al. 2015
BBX bobby sox homolog (Drosophila) 56987 A8K6U2 IP; LC-MS/MS
Huttlin EL , et al. 2015
BIRC2 baculoviral IAP repeat containing 2 329 Q13490 ChIP
Ballestar E , et al. 2004
BLM Bloom syndrome, RecQ helicase-like 641 P54132 IP; LC-MS/MS
Huttlin EL , et al. 2015
BRD4 bromodomain containing 4 23476 O60885 ChIP-chip
Yasui DH , et al. 2007
BRIX1 BRX1, biogenesis of ribosomes, homolog (S. cerevisiae) 55299 Q8TDN6 IP; LC-MS/MS
Huttlin EL , et al. 2015
BRSK2 BR serine/threonine kinase 2 9024 Q8IWQ3 ChIP-chip
Yasui DH , et al. 2007
C10ORF2 chromosome 10 open reading frame 2 56652 Q96RR1 IP; LC-MS/MS
Huttlin EL , et al. 2015
C11ORF57 chromosome 11 open reading frame 57 55216 Q6ZUT1 IP; LC-MS/MS
Huttlin EL , et al. 2015
C18ORF21 UPF0711 protein C18orf21 83608 Q32NC0 IP; LC-MS/MS
Huttlin EL , et al. 2015
C3ORF17 chromosome 3 open reading frame 17 25871 Q6NW34 IP; LC-MS/MS
Huttlin EL , et al. 2015
C9ORF114 chromosome 9 open reading frame 114 51490 Q5T280 IP; LC-MS/MS
Huttlin EL , et al. 2015
CBX3 chromobox homolog 3 11335 Q13185 ChIP
Agarwal N , et al. 2007
CCNA2 cyclin A2 890 P20248 ChIP
Jamaluddin MD , et al. 2007
CD70 CD70 molecule 970 P32970 ChIP
Zhou Y , et al. 2011
Cdk10 cyclin-dependent kinase 10 234854 Q0VH02 RNA immunoprecipitation (RIP)
Long SW , et al. 2010
CDK5 cyclin-dependent kinase 5 1020 Q00535 in vivo kinase assay
Liang Z , et al. 2015
CDK5R1 cyclin-dependent kinase 5, regulatory subunit 1 (p35) 8851 Q15078 in vivo kinase assay
Liang Z , et al. 2015
CDKL5 cyclin-dependent kinase-like 5 6792 O76039 GST; IP/WB
Mari F , et al. 2005
CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 1029 P42771 ChIP
Lin RK , et al. 2006
CEBPA CCAAT/enhancer binding protein (C/EBP), alpha 1050 P49715 ChIP
Tada Y , et al. 2006
CEBPZ CCAAT/enhancer binding protein (C/EBP), zeta 10153 Q03701 IP; LC-MS/MS
Huttlin EL , et al. 2015
CENPV centromere protein V 201161 Q7Z7K6 IP; LC-MS/MS
Huttlin EL , et al. 2015
CHMP1A charged multivesicular body protein 1A 5119 A6NG32 IP; LC-MS/MS
Huttlin EL , et al. 2015
CHRFAM7A CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion 89832 Q494W8 ChIP-chip
Yasui DH , et al. 2011
CHRNA7 cholinergic receptor, nicotinic, alpha 7 (neuronal) 1139 P36544 ChIP-chip
Yasui DH , et al. 2011
CHUK conserved helix-loop-helix ubiquitous kinase 1147 O15111 IP/WB; in vitro kinase assay
Khoshnan A and Patterson PH 2012
CLU clusterin 1191 P10909 ChIP
Gibson JH , et al. 2010
CRMP1 collapsin response mediator protein 1 1400 B3KT07 ChIP
Gibson JH , et al. 2010
CROCC ciliary rootlet coiled-coil, rootletin 9696 Q5TZA2 ChIP
Artuso R , et al. 2011
CSE1L CSE1 chromosome segregation 1-like (yeast) 1434 P55060 ChIP
Ballestar E , et al. 2004
CTCF CCCTC-binding factor (zinc finger protein) 10664 B5MC38 ChIP
Nagarajan RP , et al. 2009
DDX21 DEAD (Asp-Glu-Ala-Asp) box helicase 21 9188 Q9NR30 IP; LC-MS/MS
Huttlin EL , et al. 2015
DDX23 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 9416 Q9BUQ8 IP; LC-MS/MS
Tsujimura K , et al. 2015
DDX24 DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 57062 Q9GZR7 IP; LC-MS/MS
Huttlin EL , et al. 2015
DDX25 DEAD (Asp-Glu-Ala-Asp) box helicase 25 29118 Q9UHL0 IP; LC-MS/MS
Tsujimura K , et al. 2015
DDX27 DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 55661 Q96GQ7 IP; LC-MS/MS
Tsujimura K , et al. 2015
DDX31 DEAD (Asp-Glu-Ala-Asp) box polypeptide 31 64794 Q9H8H2 IP; LC-MS/MS
Huttlin EL , et al. 2015
DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1654 O00571 IP; LC-MS/MS
Tsujimura K , et al. 2015
DDX50 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 79009 Q9BQ39 IP; LC-MS/MS
Tsujimura K , et al. 2015
DDX51 DEAD (Asp-Glu-Ala-Asp) box polypeptide 51 317781 Q8N8A6 IP; LC-MS/MS
Huttlin EL , et al. 2015
DDX54 DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 79039 Q8TDD1 IP; LC-MS/MS
Huttlin EL , et al. 2015
DDX56 DEAD (Asp-Glu-Ala-Asp) box helicase 56 54606 Q9NY93 IP; LC-MS/MS
Huttlin EL , et al. 2015
DGCR8 DiGeorge syndrome critical region gene 8 54487 Q8WYQ5 IP; LC-MS/MS
Huttlin EL , et al. 2015
DHX16 DEAH (Asp-Glu-Ala-His) box polypeptide 16 8449 O60231 IP; LC-MS/MS
Tsujimura K , et al. 2015
DHX30 DEAH (Asp-Glu-Ala-His) box polypeptide 30 22907 Q7L2E3 IP; LC-MS/MS
Tsujimura K , et al. 2015
DHX36 DEAH (Asp-Glu-Ala-His) box polypeptide 36 170506 Q9H2U1 IP; LC-MS/MS
Tsujimura K , et al. 2015
DHX37 DEAH (Asp-Glu-Ala-His) box polypeptide 37 57647 Q8IY37 IP; LC-MS/MS
Tsujimura K , et al. 2015
DHX9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 1660 Q08211 IP; LC-MS/MS
Tsujimura K , et al. 2015
DLX5 distal-less homeobox 5 1749 P56178 ChIP; WB; qRT-PCR; Southern blot; ChIP-loop assay
Horike S , et al. 2004
DLX6 distal-less homeobox 6 1750 J3KR92 ChIP; WB; qRT-PCR; Southern blot; ChIP-loop assay
Horike S , et al. 2004
DNM1 dynamin 1 1759 Q05193 ChIP
Gibson JH , et al. 2010
E2F1 E2F transcription factor 1 1869 Q01094 Luciferase reporter assay
Matsumura S , et al. 2009
EGR2 early growth response 2 1959 P11161 ChIP
Swanberg SE , et al. 2008
EIF2AK2 eukaryotic translation initiation factor 2-alpha kinase 2 5610 P19525 IP; LC-MS/MS
Huttlin EL , et al. 2015
EP300 E1A binding protein p300 2033 Q9Y6B2 IP/WB; in vitro acetylation assay
Zocchi L and Sassone-Corsi P 2012
ESF1 ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) 51575 Q9H501 IP; LC-MS/MS
Huttlin EL , et al. 2015
ESR1 estrogen receptor 1 2099 P03372 ChIP
Rasti M , et al. 2011
FCF1 FCF1 small subunit (SSU) processome component homolog (S. cerevisiae) 51077 Q4FZ45 IP; LC-MS/MS
Huttlin EL , et al. 2015
FHIT fragile histidine triad gene 2272 P49789 ChIP
Lin RK , et al. 2006
FHL1 four and a half LIM domains 1 2273 Q13642 ChIP
Ballestar E , et al. 2004
FMR1 fragile X mental retardation 1 2332 G8JLE9 PAR-CLIP; RNA immunoprecipitation (RIP)
Ascano M Jr , et al. 2012
FOXG1 forkhead box G1 2290 P55316 IP/WB
Dastidar SG , et al. 2012
Frg1 FSHD region gene 1 14300 P97376 RNA immunoprecipitation (RIP)
Long SW , et al. 2010
FUS fused in sarcoma 2521 P35637 in vivo splicing assay; Co-localization
Coady TH and Manley JL 2015
FXR2 Fragile X retardation 2 9513 P51116 IP; LC-MS/MS
Huttlin EL , et al. 2015
GABRB3 gamma-aminobutyric acid (GABA) A receptor, beta 3 2562 P28472 ChIP
Hogart A , et al. 2007
GAD1 glutamate decarboxylase 1 (brain, 67kDa) 2571 Q8IVA8 ChIP; Methylated DNA immunoprecipitation (MeDIP)
Zhubi A , et al. 2014
GAD2 Glutamate decarboxylase 2 2572 Q05329 ChIP; Methylated DNA immunoprecipitation (MeDIP)
Zhubi A , et al. 2014
GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 2782 P62873 ChIP
Gibson JH , et al. 2010
GNL2 guanine nucleotide binding protein-like 2 (nucleolar) 29889 Q13823 IP; LC-MS/MS
Huttlin EL , et al. 2015
GSTP1 glutathione S-transferase pi 1 2950 P09211 ChIP
Stirzaker C , et al. 2004
GTF2B general transcription factor IIB 2959 Q00403 GST
Kaludov NK and Wolffe AP 2000
GTF2F2 general transcription factor IIF, polypeptide 2, 30kDa 2963 P13984 ChIP-chip
Yasui DH , et al. 2007
GTPBP10 GTP-binding protein 10 (putative) 85865 A4D1E9 IP; LC-MS/MS
Huttlin EL , et al. 2015
GTPBP4 GTP binding protein 4 23560 D2CFK9 IP; LC-MS/MS
Huttlin EL , et al. 2015
H19 H19 fetal liver mRNA 14955 N/A Luciferase reporter assay
Drewell RA , et al. 2002
HDAC1 histone deacetylase 1 3065 Q13547 IP/WB; GST
Nan X , et al. 1998
HDAC2 histone deacetylase 2 3066 Q92769 GST
Nan X , et al. 1998
HIPK2 homeodomain interacting protein kinase 2 28996 Q9H2X6 Y2H; IP/WB; in vitro kinase assay
Bracaglia G , et al. 2009
HIRA HIR histone cell cycle regulation defective homolog A (S. cerevisiae) 7290 P54198 IP; LC-MS/MS
Huttlin EL , et al. 2015
HIST1H1T Histone H1t 3010 P22492 IP; LC-MS/MS
Huttlin EL , et al. 2015
HIST2H2BF histone cluster 2, H2bf 440689 Q5QNW6 IP; LC-MS/MS
Huttlin EL , et al. 2015
HMGN1 high mobility group nucleosome binding domain 1 3150 P05114 ChIP
Abuhatzira L , et al. 2011
HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 3178 P09651 ChIP-chip
Yasui DH , et al. 2007
HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 3178 P09651 IP; LC-MS/MS
Tsujimura K , et al. 2015
HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 3181 P22626 ChIP-chip
Yasui DH , et al. 2007
HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 220988 P51991 IP; LC-MS/MS
Tsujimura K , et al. 2015
HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 3183 P07910 IP; LC-MS/MS
Tsujimura K , et al. 2015
HNRNPF eterogeneous nuclear ribonucleoprotein F 3185 P52597 UV-cross-linking assay; EMSA
Newnham CM , et al. 2010
HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 (H) 3187 P31943 IP; LC-MS/MS
Tsujimura K , et al. 2015
HNRNPK heterogeneous nuclear ribonucleoprotein K 3190 P61978 IP; LC-MS/MS
Tsujimura K , et al. 2015
HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog 3265 P01112 ChIP-chip
Yasui DH , et al. 2007
HSPB1 heat shock 27kDa protein 1 3315 P04792 Luciferase reporter assay; ChIP
Leoh LS , et al. 2012
ID1 inhibitor of DNA binding 1, dominant negative helix-loop-helix protein 3397 P41134 ChIP
Peddada S , et al. 2006
ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein 3398 Q02363 ChIP
Peddada S , et al. 2006
ID3 inhibitor of DNA binding 3, dominant negative helix-loop-helix protein 3399 Q02535 ChIP
Peddada S , et al. 2006
ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 3400 P47928 ChIP
Peddada S , et al. 2006
IGF2 insulin-like growth factor 2 (somatomedin A) 3481 P01344 ChIP
Ballestar E , et al. 2003
IGFBP2 insulin-like growth factor binding protein 2, 36kDa 3485 P18065 ChIP
Ballestar E , et al. 2004
IL6 interleukin 6 (interferon, beta 2) 3569 B4DVM1 ChIP
Dandrea M , et al. 2009
ITGB3BP integrin beta 3 binding protein (beta3-endonexin) 23421 Q13352 IP; LC-MS/MS
Huttlin EL , et al. 2015
JMJD1C jumonji domain containing 1C 221037 Q15652 IP/WB
Sez MA , et al. 2015
JUNB jun B proto-oncogene 3726 P17275 ChIP
Yasui DH , et al. 2007
KHSRP KH-type splicing regulatory protein 8570 Q92945 ChIP-chip
Yasui DH , et al. 2007
KIF25-AS1 KIF25 antisense RNA 1 100505879 Q9Y6Z4 ChIP
Artuso R , et al. 2011
KPNA3 karyopherin alpha 3 (importin alpha 4) 3839 O00505 IP; LC-MS/MS
Huttlin EL , et al. 2015
KPNA3 karyopherin alpha 3 (importin alpha 4) 3839 O00505 IP; LC-MS/MS; IP/WB; in vitro binding assay
Baker SA , et al. 2015
KPNA4 karyopherin alpha 4 (importin alpha 3) 3840 O00629 IP; LC-MS/MS
Huttlin EL , et al. 2015
KPNA4 karyopherin alpha 4 (importin alpha 3) 3840 O00629 IP; LC-MS/MS; IP/WB; in vitro binding assay
Baker SA , et al. 2015
KPNB1 karyopherin (importin) beta 1 3837 Q14974 ChIP-chip
Yasui DH , et al. 2007
LBR lamin B receptor 3930 Q14739 IP/WB
Guarda A , et al. 2009
LENG8 leukocyte receptor cluster (LRC) member 8 114823 Q96PV6 IP; LC-MS/MS
Huttlin EL , et al. 2015
LOC407840 oviduct protein p20 407840 Q6Q2J3 Far Western Blot
Carro S , et al. 2004
MAGEA1 melanoma antigen family A, 1 (directs expression of antigen MZ2-E) 4100 P43355 ChIP
Wischnewski F , et al. 2007
MAGEA2 melanoma antigen family A, 2 4101 P43356 ChIP
Wischnewski F , et al. 2007
MAGEA3 melanoma antigen family A, 3 4102 P43357 ChIP
Wischnewski F , et al. 2007
MEF2C myocyte enhancer factor 2C 4208 Q06413 Reporter assay
Zweier M , et al. 2010
METAP2 methionyl aminopeptidase 2 10988 P50579 IP; LC-MS/MS
Huttlin EL , et al. 2015
MGMT O-6-methylguanine-DNA methyltransferase 4255 P16455 ChIP
Danam RP , et al. 2005
MINA MYC induced nuclear antigen 84864 Q8IUF8 IP; LC-MS/MS
Huttlin EL , et al. 2015
miR-432 microRNA 432 574451 N/A Luciferase reporter assay; IP/WB
Das E and Bhattacharyya NP 2014
MIR132 microRNA 132 406921 N/A Luciferase reporter assay
Alvarez-Saavedra M , et al. 2010
MIR152 microRNA 152 406943 N/A ChIP
Ji W , et al. 2012
MKI67 antigen identified by monoclonal antibody Ki-67 4288 P46013 IP; LC-MS/MS
Huttlin EL , et al. 2015
MLH1 mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) 4292 P40692 ChIP
Xiong Y , et al. 2006
MPP1 membrane protein, palmitoylated 1, 55kDa 4354 Q96Q89 ChIP
Ballestar E , et al. 2004
MT1A metallothionein 1A 4489 P04731 ChIP
Majumder S , et al. 2005
MYBBP1A MYB binding protein (P160) 1a 10514 Q9BQG0 IP; LC-MS/MS
Huttlin EL , et al. 2015
NAT10 N-acetyltransferase 10 (GCN5-related) 55226 B4DFD5 IP; LC-MS/MS
Huttlin EL , et al. 2015
NCOR1 nuclear receptor corepressor 1 9611 O75376 GST
Kokura K , et al. 2001
NEMF nuclear export mediator factor 9147 O60524 IP/WB; GST
Long SW , et al. 2010
NET1 neuroepithelial cell transforming 1 10276 Q5SQI5 ChIP
Ballestar E , et al. 2004
NEUROG1 neurogenin 1 4762 F1T0H3 ChIP
Shu L , et al. 2011
NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 84901 Q8NCF5 ChIP
Artuso R , et al. 2011
NFIC nuclear factor I/C (CCAAT-binding transcription factor) 4782 B7Z4T6 Supershift assay
Ray BK , et al. 2012
NFIX nuclear factor I/X (CCAAT-binding transcription factor) 4784 Q14938 Supershift assay
Ray BK , et al. 2012
NFY Nuclear transcription factor Y subunit alpha 4800 P23511 ChIP-Seq
Vitezic M , et al. 2014
NLE1 notchless homolog 1 (Drosophila) 54475 Q9NVX2 IP; LC-MS/MS
Huttlin EL , et al. 2015
NOC2L nucleolar complex associated 2 homolog (S. cerevisiae) 26155 Q9Y3T9 IP; LC-MS/MS
Huttlin EL , et al. 2015
NOL6 nucleolar protein 6 (RNA-associated) 65083 Q9H6R4 IP; LC-MS/MS
Huttlin EL , et al. 2015
NOL8 nucleolar protein 8 55035 A6H8Z4 IP; LC-MS/MS
Huttlin EL , et al. 2015
NOP16 NOP16 nucleolar protein 51491 Q6PIM0 IP; LC-MS/MS
Huttlin EL , et al. 2015
NOP2 NOP2 nucleolar protein 4839 P46087 IP; LC-MS/MS
Huttlin EL , et al. 2015
NOS2 nitric oxide synthase 2, inducible 4843 P35228 ChIP
Angrisano T , et al. 2012
NOS3 nitric oxide synthase 3 (endothelial cell) 4846 P60323 ChIP
Fish JE , et al. 2005
NSD1 nuclear receptor binding SET domain protein 1 64324 Q96L73 IP; LC-MS/MS
Huttlin EL , et al. 2015
NUP133 nucleoporin 133kDa 55746 Q8WUM0 ChIP-chip
Yasui DH , et al. 2007
NVL nuclear VCP-like 4931 B4DF43 IP; LC-MS/MS
Huttlin EL , et al. 2015
OR4K1 olfactory receptor, family 4, subfamily K, member 1 79544 Q8NGD4 ChIP
Artuso R , et al. 2011
OR4Q3 olfactory receptor, family 4, subfamily Q, member 3 441669 Q8NH05 ChIP
Artuso R , et al. 2011
PAM peptidylglycine alpha-amidating monooxygenase 5066 P19021 ChIP
Ballestar E , et al. 2004
PAX6 paired box 6 5080 P26367 ChIP
Ballestar E , et al. 2003
PCDHB1 protocadherin beta 1 29930 Q9Y5F3 ChIP
Miyake K , et al. 2011
PCDHB7 protocadherin beta 7 56129 Q9Y5E2 ChIP
Miyake K , et al. 2011
PDCD11 programmed cell death 11 22984 Q14690 IP; LC-MS/MS
Huttlin EL , et al. 2015
Per1 period homolog 1 (Drosophila) 18626 O35973 ChIP
Alvarez-Saavedra M , et al. 2010
Per2 period circadian clock 2 18627 O54943 ChIP
Alvarez-Saavedra M , et al. 2010
PGK1 phosphoglycerate kinase 1 5230 P00558 ChIP
Ballestar E , et al. 2004
PIKFYVE phosphoinositide kinase, FYVE finger containing 200576 Q9Y2I7 ChIP
Ballestar E , et al. 2003
PLA2G16 phospholipase A2, group XVI 11145 P53816 ChIP-chip
Yasui DH , et al. 2007
PRDX1 peroxiredoxin 1 5052 Q06830 ChIP-chip
Yasui DH , et al. 2007
PRPF3 PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae) 9129 O43395 IP/WB; GST
Long SW , et al. 2010
PRPF40B PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae) 25766 Q6NWY9 GST; ChIP
Buschdorf JP and Strtling WH 2003
PSIP1 PC4 and SFRS1 interacting protein 1 11168 O75475 Protein microarray; GST; IP/WB
Leoh LS , et al. 2012
PWP2 PWP2 periodic tryptophan protein homolog (yeast) 5822 Q15269 IP; LC-MS/MS
Huttlin EL , et al. 2015
RARB retinoic acid receptor, beta 5915 F1D8S6 ChIP
Ballestar E , et al. 2003
RASSF1 Ras association (RalGDS/AF-6) domain family member 1 11186 Q9NS23 ChIP
Ballestar E , et al. 2003
RBAK RB-associated KRAB zinc finger 57786 Q9NYW8 IP; LC-MS/MS
Huttlin EL , et al. 2015
RBM28 RNA binding motif protein 28 55131 B4DU52 IP; LC-MS/MS
Huttlin EL , et al. 2015
RELN reelin 5649 P78509 ChIP; Methylated DNA immunoprecipitation (MeDIP)
Zhubi A , et al. 2014
RET ret proto-oncogene 5979 P07949 ChIP
Gonzales ML , et al. 2012
RNASEH2A ribonuclease H2, subunit A 10535 O75792 ChIP-chip
Yasui DH , et al. 2007
RPF2 ribosome production factor 2 homolog (S. cerevisiae) 84154 Q9H7B2 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL10A ribosomal protein L10a 4736 P62906 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL12 ribosomal protein L12 6136 P30050 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL13 ribosomal protein L13 6137 A8K4C8 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL15 ribosomal protein L15 6138 P61313 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL17 ribosomal protein L17 6139 P18621 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL18 ribosomal protein L18 6141 Q07020 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL26L1 ribosomal protein L26-like 1 51121 Q9UNX3 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL27 ribosomal protein L27 6155 P61353 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL29 ribosomal protein L29 6159 P47914 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL3 ribosomal protein L3 6122 P39023 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL32 ribosomal protein L32 6161 P62910 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL36 ribosomal protein L36 25873 Q9Y3U8 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL5 ribosomal protein L5 6125 A2RUM7 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL7A ribosomal protein L7a 6130 P62424 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL8 ribosomal protein L8 6132 P62917 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPLP2 ribosomal protein, large, P2 6181 P05387 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPP40 ribonuclease P/MRP 40kDa subunit 10799 O75818 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPS8 ribosomal protein S8 6202 P62241 IP; LC-MS/MS
Huttlin EL , et al. 2015
RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 23076 Q14684 IP; LC-MS/MS
Huttlin EL , et al. 2015
RRP7A ribosomal RNA processing 7 homolog A (S. cerevisiae) 27341 Q9Y3A4 IP; LC-MS/MS
Huttlin EL , et al. 2015
RRP8 ribosomal RNA processing 8, methyltransferase, homolog (yeast) 23378 O43159 IP; LC-MS/MS
Huttlin EL , et al. 2015
SDAD1 SDA1 domain containing 1 55153 Q9NVU7 IP; LC-MS/MS
Huttlin EL , et al. 2015
SDHD succinate dehydrogenase complex, subunit D, integral membrane protein 6392 O14521 ChIP-chip
Yasui DH , et al. 2007
SIN3B SIN3 transcription regulator homolog B (yeast) 23309 O75182 IP; LC-MS/MS
Tsujimura K , et al. 2015
SIRT1 sirtuin 1 23411 A8K128 IP/WB; in vitro deacetylation assay
Zocchi L and Sassone-Corsi P 2012
SKI v-ski sarcoma viral oncogene homolog (avian) 6497 P12755 GST; IP/WB
Kokura K , et al. 2001
SLC6A2 solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 6530 P23975 ChIP
Esler M , et al. 2009
SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 6595 P51531 IP/WB
Harikrishnan KN , et al. 2005
SMARCB1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 6598 Q12824 IP/WB
Harikrishnan KN , et al. 2005
SMARCC2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 6601 Q8TAQ2 IP; LC-MS/MS
Tsujimura K , et al. 2015
SMARCD2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 6603 Q92925 IP; LC-MS/MS
Tsujimura K , et al. 2015
SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 6605 Q969G3 IP/WB
Harikrishnan KN , et al. 2005
SMC3 structural maintenance of chromosomes 3 9126 Q9UQE7 IP/WB
Gonzales ML , et al. 2012
SNURF SNRPN upstream reading frame 8926 Q9Y675 ChIP-chip
Yasui DH , et al. 2007
SP1 Sp1 transcription factor 6667 P08047 IP/WB
Koch C and Strtling WH 2004
SPNS1 spinster homolog 1 (Drosophila) 83985 Q9H2V7 ChIP
Artuso R , et al. 2011
SRBD1 S1 RNA binding domain 1 55133 Q8N5C6 IP; LC-MS/MS
Huttlin EL , et al. 2015
SRSF7 serine/arginine-rich splicing factor 7 6432 Q16629 ChIP-chip
Yasui DH , et al. 2007
SRSF8 Serine/arginine-rich splicing factor 8 10929 Q9BRL6-2 IP; LC-MS/MS
Huttlin EL , et al. 2015
STMN4 stathmin-like 4 81551 Q9H169 ChIP-chip
Yasui DH , et al. 2007
SYT3 synaptotagmin III 20981 G3X9Y1 ChIP-chip
Yasui DH , et al. 2007
TAF1A TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa 9015 A8K4K5 IP; LC-MS/MS
Huttlin EL , et al. 2015
TAF1B TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa 9014 Q53T94 IP; LC-MS/MS
Huttlin EL , et al. 2015
TAF1C TATA box-binding protein-associated factor RNA polymerase I subunit C 9013 Q15572-6 IP; LC-MS/MS
Huttlin EL , et al. 2015
TAF1D TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa 79101 Q9H5J8 IP; LC-MS/MS
Huttlin EL , et al. 2015
TEX10 testis expressed 10 54881 Q9NXF1 IP; LC-MS/MS
Huttlin EL , et al. 2015
TFB1M transcription factor B1, mitochondrial 51106 E5KTM5 IP; LC-MS/MS
Huttlin EL , et al. 2015
TGFB1 transforming growth factor, beta 1 7040 P01137 IP/WB; GST
Matsumura S , et al. 2009
TOP3A topoisomerase (DNA) III alpha 7156 Q13472 IP; LC-MS/MS
Huttlin EL , et al. 2015
TP53 tumor protein p53 7157 P04637 IP/WB; GST
Arabsolghar R , et al. 2012
TRIP12 thyroid hormone receptor interactor 12 9320 Q14669 IP; LC-MS/MS
Huttlin EL , et al. 2015
TRMT1L tRNA methyltransferase 1 homolog (S. cerevisiae)-like 81627 B4DXX1 IP; LC-MS/MS
Huttlin EL , et al. 2015
TRPC6 Short transient receptor potential channel 6 7225 Q9Y210 qRT-PCR; Peptide microarray; IP/WB; Immunofluorescence; Electrophysiology
Griesi-Oliveira K , et al. 2014
TSPAN4 tetraspanin 4 7106 O14817 ChIP-chip
Yasui DH , et al. 2007
TSSC1 tumor suppressing subtransferable candidate 1 7260 Q53HC9 ChIP
Artuso R , et al. 2011
TUBGCP5 tubulin, gamma complex associated protein 5 114791 E9PB12 ChIP-chip
Yasui DH , et al. 2007
UCHL1 ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) 7345 P09936 ChIP-chip
Yasui DH , et al. 2007
URB1 URB1 ribosome biogenesis 1 homolog (S. cerevisiae) 9875 O60287 IP; LC-MS/MS
Huttlin EL , et al. 2015
URB2 URB2 ribosome biogenesis 2 homolog (S. cerevisiae) 9816 Q14146 IP; LC-MS/MS
Huttlin EL , et al. 2015
VEGFA vascular endothelial growth factor A 7422 P15692 EMSA
Lapchak PH , et al. 2004
WDR36 WD repeat domain 36 134430 Q68E02 IP; LC-MS/MS
Huttlin EL , et al. 2015
WDR83OS WD repeat domain 83 opposite strand 51398 Q9Y284 ChIP-chip
Yasui DH , et al. 2007
YBX1 Y box binding protein 1 4904 P67809 IP/WB
Young JI , et al. 2005
YBX1 Y box binding protein 1 4904 P67809 IP; LC-MS/MS
Tsujimura K , et al. 2015
ZCCHC17 zinc finger, CCHC domain containing 17 51538 Q9NP64 IP; LC-MS/MS
Huttlin EL , et al. 2015
ZNF354A zinc finger protein 354A 6940 O60765 IP; LC-MS/MS
Huttlin EL , et al. 2015
ZNF483 zinc finger protein 483 158399 Q8TF39 IP; LC-MS/MS
Huttlin EL , et al. 2015
ZNF593 Zinc finger protein 593 51042 O00488 IP; LC-MS/MS
Huttlin EL , et al. 2015
ZNF800 zinc finger protein 800 168850 Q2TB10 IP; LC-MS/MS
Huttlin EL , et al. 2015
Arrdc4 arrestin domain containing 4 66412 Q8VD69 ChIP
Horike S , et al. 2004
ATRX alpha thalassemia/mental retardation syndrome X-linked homolog (human) 22589 Q61687 qRT-PCR; ChIP; Chromatin conformation capture
Kernohan KD , et al. 2014
Cacna2d3 calcium channel, voltage-dependent, alpha2/delta subunit 3 12294 Q9Z1L5 ChIP
Horike S , et al. 2004
Camk2a calcium/calmodulin-dependent protein kinase II alpha 12322 P11798 IP; LC-MS/MS
Li R , et al. 2016
Camk2b calcium/calmodulin-dependent protein kinase II, beta 12323 P28652 IP; LC-MS/MS
Li R , et al. 2016
Camk2d calcium/calmodulin-dependent protein kinase II, delta 108058 Q6PHZ2 IP; LC-MS/MS
Li R , et al. 2016
Camk2g calcium/calmodulin-dependent protein kinase II gamma 12325 Q923T9 IP; LC-MS/MS
Li R , et al. 2016
CamKII Calcium/calmodulin-dependent protein kinase type II subunit delta 108058 Q6PHZ2 M2 affinity gel assay; IP/WB; Immunohistochemistry; qRT-PCR; in vitro kinase assay
Zhou Z , et al. 2006
CamKIV Calcium/calmodulin-dependent protein kinase type IV P08414 IP/WB; ChIP; in vitro kinase assay; qRT-PCR
Tao J , et al. 2009
Cbx1 chromobox 1 12412 P83917 IP; LC-MS/MS
Li R , et al. 2016
Cbx3 chromobox 3 12417 P23198 IP; LC-MS/MS
Li R , et al. 2016
Cbx5 chromobox homolog 5 23468 P45973 IP/WB
Agarwal N , et al. 2007
Cbx5 chromobox homolog 5 23468 P45973 IP; LC-MS/MS
Li R , et al. 2016
Cdk7 cyclin-dependent kinase 7 12572 Q03147 IP; LC-MS/MS
Li R , et al. 2016
Cntn2 contactin 2 21367 Q61330 ChIP
Horike S , et al. 2004
Crh corticotropin releasing hormone 12918 Q8CIT0 ChIP
McGill BE , et al. 2006
Csnk2b casein kinase 2, beta polypeptide 13001 P67871 IP; LC-MS/MS
Li R , et al. 2016
Cyc1 cytochrome c-1 66445 Q9D0M3 ChIP
Horike S , et al. 2004
Ddx1 DEAD (Asp-Glu-Ala-Asp) box polypeptide 1 104721 Q91VR5 IP; LC-MS/MS
Tsujimura K , et al. 2015
Ddx10 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 77591 Q80Y44 IP; LC-MS/MS
Tsujimura K , et al. 2015
Ddx17 DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 67040 Q501J6 IP; LC-MS/MS
Tsujimura K , et al. 2015
Ddx5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 13207 Q8BTS0 IP; LC-MS/MS; IP/WB
Tsujimura K , et al. 2015
Ddx5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 13207 Q8BTS0 IP; LC-MS/MS
Li R , et al. 2016
DGCR8 Microprocessor complex subunit DGCR8 94223 Q9EQM6 GST; IP/WB; FRET
Cheng TL , et al. 2014
Dgcr8 Microprocessor complex subunit DGCR8 94223 Q9EQM6 IP/WB
Tsujimura K , et al. 2015
Dhx9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 13211 O70133 IP; LC-MS/MS; IP/WB
Li R , et al. 2016
Dlx3 distal-less homeobox 3 13393 Q64205 ChIP
Horike S , et al. 2004
Dlx4 distal-less homeobox 4 1748 Q92988 ChIP
Horike S , et al. 2004
Dmpk dystrophia myotonica-protein kinase 13400 P54265 ChIP
Horike S , et al. 2004
Dmwd dystrophia myotonica-containing WD repeat motif 13401 Q08274 ChIP
Horike S , et al. 2004
Drosha Ribonuclease 3 14000 Q5HZJ0 IP/WB
Tsujimura K , et al. 2015
Eif5b eukaryotic translation initiation factor 5B 226982 Q05D44 IP; LC-MS/MS
Li R , et al. 2016
Evc Ellis van Creveld gene syndrome 59056 P57680 ChIP
Horike S , et al. 2004
Exosc4 exosome component 4 109075 Q542B0 ChIP
Horike S , et al. 2004
Fam19a1 family with sequence similarity 19, member A1 320265 Q7TPG8 ChIP
Horike S , et al. 2004
Fam203a family with sequence similarity 203, member A 59053 Q8C3I8 ChIP
Horike S , et al. 2004
Fbxo46 F-box protein 46 243867 Q8BG80 ChIP
Horike S , et al. 2004
Foxa3 forkhead box A3 15377 P35584 ChIP
Horike S , et al. 2004
Fras1 Fraser syndrome 1 homolog (human) 231470 Q80T14 ChIP
Horike S , et al. 2004
Fus fused in sarcoma 233908 P56959 IP; LC-MS/MS; IP/WB
Li R , et al. 2016
Fut8 fucosyltransferase 8 53618 Q9WTS2 ChIP
Horike S , et al. 2004
Fxyd1 FXYD domain containing ion transport regulator 1 56188 Q9Z239 ChIP
Jordan C , et al. 2007
Gad1 glutamate decarboxylase 1 (brain, 67kDa) 14415 P48318 ChIP
Dong E , et al. 2005
Gad2 glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) 14417 P48320 ChIP
Dong E , et al. 2005
Gpaa1 GPI anchor attachment protein 1 14731 Q9WTK3 ChIP
Horike S , et al. 2004
Gria2 glutamate receptor, ionotropic, AMPA2 (alpha 2) 14800 P23819 RNA-Seq; ChIP; qRT-PCR
Li R , et al. 2016
Grina glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) 66168 Q9ESF4 ChIP
Horike S , et al. 2004
Grm2 glutamate receptor, metabotropic 2 108068 Q14BI2 ChIP
Matrisciano F , et al. 2011
Hdac1 Histone deacetylase 1 433759 O09106 IP; LC-MS/MS
Tsujimura K , et al. 2015
Hdac1 Histone deacetylase 1 433759 O09106 IP; LC-MS/MS; IP/WB
Li R , et al. 2016
Hdac2 Histone deacetylase 2 15182 P70288 IP; LC-MS/MS
Tsujimura K , et al. 2015
Hnrnpa2b1 heterogeneous nuclear ribonucleoprotein A2/B1 53379 O88569 IP; LC-MS/MS
Tsujimura K , et al. 2015
Hnrnpc heterogeneous nuclear ribonucleoprotein C 15381 Q9Z204 IP; LC-MS/MS
Tsujimura K , et al. 2015
Hnrnpc heterogeneous nuclear ribonucleoprotein C 15381 Q9Z204 IP; LC-MS/MS
Li R , et al. 2016
Hnrnpd heterogeneous nuclear ribonucleoprotein D 11991 Q60668 IP; LC-MS/MS
Tsujimura K , et al. 2015
Hnrnpf heterogeneous nuclear ribonucleoprotein F 98758 Q9Z2X1 IP; LC-MS/MS
Li R , et al. 2016
Hnrnph1 heterogeneous nuclear ribonucleoprotein H1 59013 O35737 IP; LC-MS/MS
Li R , et al. 2016
Hnrnph2 heterogeneous nuclear ribonucleoprotein H2 56258 P70333 IP; LC-MS/MS
Tsujimura K , et al. 2015
Hnrnph2 heterogeneous nuclear ribonucleoprotein H2 56258 P70333 IP; LC-MS/MS
Li R , et al. 2016
Hnrnpm heterogeneous nuclear ribonucleoprotein M 76936 Q9D0E1 IP; LC-MS/MS
Tsujimura K , et al. 2015
Hnrnpm heterogeneous nuclear ribonucleoprotein M 76936 Q9D0E1 IP; LC-MS/MS
Li R , et al. 2016
Hnrnpu heterogeneous nuclear ribonucleoprotein U 51810 Q8VEK3 IP; LC-MS/MS
Tsujimura K , et al. 2015
Hnrnpul2 heterogeneous nuclear ribonucleoprotein U-like 2 68693 Q00PI9 IP; LC-MS/MS
Li R , et al. 2016
Ifng interferon gamma 15978 P01580 ChIP
Yang T , et al. 2012
Igfbp3 insulin-like growth factor binding protein 3 24484 P15473 ChIP
Itoh M , et al. 2007
Irf2bp1 interferon regulatory factor 2 binding protein 1 272359 Q8R3Y8 ChIP
Horike S , et al. 2004
Itga3 integrin alpha 3 16400 Q62470 ChIP
Horike S , et al. 2004
Jakmip1 janus kinase and microtubule interacting protein 1 76071 Q8BVL9 ChIP
Horike S , et al. 2004
Kat7 K(lysine) acetyltransferase 7 217127 Q1AJD0 ChIP
Horike S , et al. 2004
Kirrel2 kin of IRRE like 2 (Drosophila) 243911 Q7TSU7 ChIP
Lee W , et al. 2014
Lrrc7 leucine rich repeat containing 7 242274 Q80TE7 ChIP
Horike S , et al. 2004
Maf1 MAF1 homolog (S. cerevisiae) 68877 Q9D0U6 ChIP
Horike S , et al. 2004
Matr3 matrin 3 17184 Q8K310 IP; LC-MS/MS
Li R , et al. 2016
Mbd2 methyl-CpG binding domain protein 2 17191 Q9Z2E1 IP; LC-MS/MS
Li R , et al. 2016
Mbd3 methyl-CpG binding domain protein 3 17192 Q9Z2D8 IP; LC-MS/MS
Li R , et al. 2016
Meg3 maternally expressed 3 (non-protein coding) 17263 Q8CCV7 ChIP
Jordan C , et al. 2007
miR-132 microRNA 132 387150 N/A qRT-PCR; IP/WB; Immunofluorescence
Sadegh MK , et al. 2015
miR-212 microRNA 212 387208 N/A qRT-PCR; IP/WB; Immunofluorescence
Sadegh MK , et al. 2015
Mir106a microRNA 106a 723829 N/A ChIP-chip
Wu H , et al. 2010
Mir124b microRNA 124b 387234 N/A ChIP-chip
Wu H , et al. 2010
Mir128-2 microRNA 128-2 723815 N/A ChIP-chip
Wu H , et al. 2010
Mir134 microRNA 134 387152 N/A ChIP-chip
Wu H , et al. 2010
Mir135a1 microRNA 135a-1 387153 N/A ChIP-chip
Wu H , et al. 2010
Mir137 microRNA 137 387155 N/A ChIP-chip
Wu H , et al. 2010
Mir139 microRNA 139 387157 N/A ChIP-chip
Wu H , et al. 2010
Mir142 microRNA 142 387160 N/A ChIP-chip
Wu H , et al. 2010
Mir143 microRNA 143 387161 N/A ChIP-chip
Wu H , et al. 2010
Mir145 microRNA 145 387163 N/A ChIP-chip
Wu H , et al. 2010
Mir148b microRNA 148b 724064 N/A ChIP-chip
Wu H , et al. 2010
Mir150 microRNA 150 387168 N/A ChIP-chip
Wu H , et al. 2010
Mir151 microRNA 151 387169 N/A ChIP-chip
Wu H , et al. 2010
Mir154 microRNA 154 387172 N/A ChIP-chip
Wu H , et al. 2010
Mir17 microRNA 17 723905 N/A ChIP-chip
Wu H , et al. 2010
Mir18 microRNA 18 387135 N/A ChIP-chip
Wu H , et al. 2010
Mir181c microRNA 181c 723819 N/A ChIP-chip
Wu H , et al. 2010
Mir181d microRNA 181d 100049549 N/A ChIP-chip
Wu H , et al. 2010
Mir193b microRNA 193b 100124432 N/A ChIP-chip
Wu H , et al. 2010
Mir195 microRNA 195 387190 N/A ChIP-chip
Wu H , et al. 2010
Mir19a microRNA 19a 723891 N/A ChIP-chip
Wu H , et al. 2010
Mir204 microRNA 204 387200 N/A ChIP-chip
Wu H , et al. 2010
Mir205 microRNA 205 387201 N/A ChIP-chip
Wu H , et al. 2010
Mir207 microRNA 207 387203 N/A ChIP-chip
Wu H , et al. 2010
Mir20a microRNA 20a 387139 N/A ChIP-chip
Wu H , et al. 2010
Mir211 microRNA 211 387207 N/A ChIP-chip
Wu H , et al. 2010
Mir25 microRNA 25 723926 N/A ChIP-chip
Wu H , et al. 2010
Mir28 microRNA 28 723830 N/A ChIP-chip
Wu H , et al. 2010
Mir299 microRNA 299 723927 N/A ChIP-chip
Wu H , et al. 2010
Mir300 microRNA 300 723833 N/A ChIP-chip
Wu H , et al. 2010
Mir302a microRNA 302a 723920 N/A ChIP-chip
Wu H , et al. 2010
Mir302b microRNA 302b 723948 N/A ChIP-chip
Wu H , et al. 2010
Mir302c microRNA 302c 723835 N/A ChIP-chip
Wu H , et al. 2010
Mir302d microRNA 302d 723928 N/A ChIP-chip
Wu H , et al. 2010
Mir30c-1 microRNA 30c-1 387227 N/A ChIP-chip
Wu H , et al. 2010
Mir30e microRNA 30e 723836 N/A ChIP-chip
Wu H , et al. 2010
Mir323 microRNA 323 723839 N/A ChIP-chip
Wu H , et al. 2010
Mir326 microRNA 326 723840 N/A ChIP-chip
Wu H , et al. 2010
Mir329 microRNA 329 723842 N/A ChIP-chip
Wu H , et al. 2010
Mir33 microRNA 33 723897 N/A ChIP-chip
Wu H , et al. 2010
Mir330 microRNA 330 724063 N/A ChIP-chip
Wu H , et al. 2010
Mir338 microRNA 338 723844 N/A ChIP-chip
Wu H , et al. 2010
Mir339 microRNA 339 723898 N/A ChIP-chip
Wu H , et al. 2010
Mir341 microRNA 341 723846 N/A ChIP-chip
Wu H , et al. 2010
Mir345 microRNA 345 723946 N/A ChIP-chip
Wu H , et al. 2010
Mir34b microRNA 34b 723849 N/A ChIP-chip
Wu H , et al. 2010
Mir34c microRNA 34c 723932 N/A ChIP-chip
Wu H , et al. 2010
Mir365-1 microRNA 365-1 723899 N/A ChIP-chip
Wu H , et al. 2010
Mir367 microRNA 367 723911 N/A ChIP-chip
Wu H , et al. 2010
Mir369 microRNA 369 723933 N/A ChIP-chip
Wu H , et al. 2010
Mir370 microRNA 370 723854 N/A ChIP-chip
Wu H , et al. 2010
Mir376a microRNA 376a 723855 N/A ChIP-chip
Wu H , et al. 2010
Mir376b microRNA 376b 723934 N/A ChIP-chip
Wu H , et al. 2010
Mir376c microRNA 376c 723856 N/A ChIP-chip
Wu H , et al. 2010
Mir377 microRNA 377 723857 N/A ChIP-chip
Wu H , et al. 2010
Mir378 microRNA 378 723889 N/A ChIP-chip
Wu H , et al. 2010
Mir379 microRNA 379 723858 N/A ChIP-chip
Wu H , et al. 2010
Mir380 microRNA 380 723859 N/A ChIP-chip
Wu H , et al. 2010
Mir381 microRNA 381 723935 N/A ChIP-chip
Wu H , et al. 2010
Mir382 microRNA 382 723912 N/A ChIP-chip
Wu H , et al. 2010
Mir409 microRNA 409 723862 N/A ChIP-chip
Wu H , et al. 2010
Mir410 microRNA 410 723863 N/A ChIP-chip
Wu H , et al. 2010
Mir411 microRNA 411 723936 N/A ChIP-chip
Wu H , et al. 2010
Mir412 microRNA 412 723913 N/A ChIP-chip
Wu H , et al. 2010
Mir449a microRNA 449a 723868 N/A ChIP-chip
Wu H , et al. 2010
Mir449b microRNA 449b 100190765 N/A ChIP-chip
Wu H , et al. 2010
Mir453 microRNA 453 100124484 N/A ChIP-chip
Wu H , et al. 2010
Mir485 microRNA 485 723875 N/A ChIP-chip
Wu H , et al. 2010
Mir487b microRNA 487b 723940 N/A ChIP-chip
Wu H , et al. 2010
Mir488 microRNA 488 735253 N/A ChIP-chip
Wu H , et al. 2010
Mir494 microRNA 494 723878 N/A ChIP-chip
Wu H , et al. 2010
Mir495 microRNA 495 751522 N/A ChIP-chip
Wu H , et al. 2010
Mir496 microRNA 496 751524 N/A ChIP-chip
Wu H , et al. 2010
Mir497 microRNA 497 751537 N/A ChIP-chip
Wu H , et al. 2010
Mir539 microRNA 539 723917 N/A ChIP-chip
Wu H , et al. 2010
Mir541 microRNA 541 723941 N/A ChIP-chip
Wu H , et al. 2010
Mir543 microRNA 543 723881 N/A ChIP-chip
Wu H , et al. 2010
Mir544 microRNA 544 100124450 N/A ChIP-chip
Wu H , et al. 2010
Mir654 microRNA 654 100124453 N/A ChIP-chip
Wu H , et al. 2010
Mir666 microRNA 666 751521 N/A ChIP-chip
Wu H , et al. 2010
Mir671 microRNA 671 735264 N/A ChIP-chip
Wu H , et al. 2010
Mir7-1 microRNA 7-1 723902 N/A ChIP-chip
Wu H , et al. 2010
Mir708 microRNA 708 735284 N/A ChIP-chip
Wu H , et al. 2010
Mir758 microRNA 758 791071 N/A ChIP-chip
Wu H , et al. 2010
Mir802 microRNA 802 791074 N/A ChIP-chip
Wu H , et al. 2010
Mir882 microRNA 882 100124461 N/A ChIP-chip
Wu H , et al. 2010
Mir9-1 microRNA 9-1 387133 N/A ChIP-chip
Wu H , et al. 2010
Mir93 microRNA 93 723885 N/A ChIP-chip
Wu H , et al. 2010
Mrpl1 mitochondrial ribosomal protein L1 94061 Q9D3F3 ChIP
Horike S , et al. 2004
Mug1 murinoglobulin 1 17836 P28665 ChIP
Horike S , et al. 2004
Mug2 murinoglobulin 2 17837 P28666 ChIP
Horike S , et al. 2004
Myo3a myosin IIIA 667663 F6QNG5 ChIP
Horike S , et al. 2004
Mypop Myb-related transcription factor, partner of profilin 232934 Q8R4U1 ChIP
Horike S , et al. 2004
Nanos2 nanos homolog 2 (Drosophila) 378430 I6ZHM2 ChIP
Horike S , et al. 2004
Nfasc neurofascin 269116 E9PW06 ChIP
Horike S , et al. 2004
Nfkbiz nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta 80859 Q9EST8 ChIP
Horike S , et al. 2004
NFY Nuclear transcription factor Y subunit alpha 18044 P23708 ChIP-Seq
Vitezic M , et al. 2014
Ngfr nerve growth factor receptor (TNFR superfamily, member 16) 18053 Q8CFT3 ChIP
Horike S , et al. 2004
Nnmt nicotinamide N-methyltransferase 18113 O55239 ChIP
Horike S , et al. 2004
Npm1 nucleophosmin 1 18148 Q61937 IP; LC-MS/MS
Li R , et al. 2016
Nrxn3 neurexin III 18191 Q6P9K9 ChIP
Horike S , et al. 2004
Olr1 oxidized low density lipoprotein (lectin-like) receptor 1 108078 Q9EQ09 ChIP
Horike S , et al. 2004
Oplah 5-oxoprolinase (ATP-hydrolysing) 75475 Q8K010 ChIP
Horike S , et al. 2004
Oprm1 opioid receptor, mu 1 18390 P42866 ChIP
Hwang CK , et al. 2007
Pax5 paired box gene 5 18507 Q02650 ChIP
Horike S , et al. 2004
Pcdh20 protocadherin 20 219257 Q8BIZ0 ChIP
Lee W , et al. 2014
Peg10 paternally expressed 10 170676 Q7TN75 ChIP
Horike S , et al. 2004
Phb prohibitin 18673 P67778 ChIP
Horike S , et al. 2004
Plec1 plectin 18810 E9QN87 ChIP
Horike S , et al. 2004
Pomc "NPP" 18976 P01193 qRT-PCR; ChIP; Chromatin conformation capture
Torres-Andrade R , et al. 2014
Ppp1r9a protein phosphatase 1, regulatory (inhibitor) subunit 9A 243725 Q7TN74 ChIP
Horike S , et al. 2004
Prmt6 protein arginine N-methyltransferase 6 99890 Q6NZB1 IP/WB
Dhawan S , et al. 2011
Prpf19 pre-mRNA processing factor 19 28000 Q99KP6 IP; LC-MS/MS
Li R , et al. 2016
Prpf40a PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) 56194 Q9R1C7 Far Western Blot
Bedford MT , et al. 1997
Psip1 PC4 and SFRS1 interacting protein 1 101739 Q99JF8 IP; LC-MS/MS; IP/WB
Li R , et al. 2016
Pura purine rich element binding protein A 19290 P42669 IP; LC-MS/MS
Li R , et al. 2016
Rbbp4 retinoblastoma binding protein 4 19646 Q60972 IP; LC-MS/MS
Li R , et al. 2016
Rbbp5 retinoblastoma binding protein 5 213464 Q8BX09 ChIP
Horike S , et al. 2004
Rbmx RNA binding motif protein, X chromosome 19655 Q9WV02 IP; LC-MS/MS
Tsujimura K , et al. 2015
Reln reelin 19699 Q60841 ChIP
Jordan C , et al. 2007
Rsph6a radial spoke head 6 homolog A (Chlamydomonas) 83434 Q8CDR2 ChIP
Horike S , et al. 2004
Safb2 scaffold attachment factor B2 224902 Q80YR5 IP; LC-MS/MS
Li R , et al. 2016
Sap18 Sin3-associated polypeptide 18 20220 O55128 IP; LC-MS/MS
Li R , et al. 2016
Sgce sarcoglycan, epsilon 20392 O70258 ChIP
Horike S , et al. 2004
Six5 sine oculis-related homeobox 5 20475 P70178 ChIP
Horike S , et al. 2004
Smarca1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 93761 Q6PGB8 IP; LC-MS/MS
Tsujimura K , et al. 2015
Smarca2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 67155 Q6DIC0 IP; LC-MS/MS
Li R , et al. 2016
Smarca4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 20586 Q3TKT4 IP; LC-MS/MS
Tsujimura K , et al. 2015
Smarca4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 20586 Q3TKT4 IP; LC-MS/MS
Li R , et al. 2016
Smarcc1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 20588 P97496 IP; LC-MS/MS
Tsujimura K , et al. 2015
Smarcc2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 68094 Q6PDG5 IP; LC-MS/MS
Li R , et al. 2016
Smarcd1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 83797 Q61466 IP; LC-MS/MS
Li R , et al. 2016
Smarcd2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 83796 Q99JR8 IP; LC-MS/MS
Li R , et al. 2016
Smarcd3 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 66993 Q6P9Z1 IP; LC-MS/MS
Li R , et al. 2016
Smc1a structural maintenance of chromosomes 1A 24061 Q9CU62 IP/WB; ChIP
Kernohan KD , et al. 2010
Smc1a structural maintenance of chromosomes 1A 24061 Q9CU62 IP; LC-MS/MS
Li R , et al. 2016
Smc3 structural maintenance of chromosomes 3 13006 Q9CW03 IP; LC-MS/MS
Li R , et al. 2016
SNAT1 solute carrier family 38, member 1 105727 Q8K2P7 Immunofluorescence; qRT-PCR
Jin LW , et al. 2015
Snrpd3 small nuclear ribonucleoprotein D3 67332 P62320 IP; LC-MS/MS
Li R , et al. 2016
Snrpn small nuclear ribonucleoprotein N 20646 P63163 ChIP
Samaco RC , et al. 2004
Soat1 sterol O-acyltransferase 1 20652 Q61263 ChIP
Horike S , et al. 2004
SP1 trans-acting transcription factor 1 20683 O89090 ChIP-Seq
Vitezic M , et al. 2014
Spi1 spleen focus forming virus (SFFV) proviral integration oncogene spi1 20375 P17433 GST; IP/WB
Suzuki M , et al. 2003
Sprn shadow of prion protein 212518 Q8BWU1 ChIP
Horike S , et al. 2004
Srsf4 serine/arginine-rich splicing factor 4 57317 Q8VE97 IP; LC-MS/MS
Tsujimura K , et al. 2015
Srsf6 serine/arginine-rich splicing factor 6 67996 Q3TWW8 IP; LC-MS/MS
Tsujimura K , et al. 2015
Srsf7 serine/arginine-rich splicing factor 7 225027 Q8BL97 IP; LC-MS/MS
Tsujimura K , et al. 2015
St3gal1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 20442 P54751 ChIP
Horike S , et al. 2004
Syt13 synaptotagmin XIII 80976 Q9EQT6 ChIP
Horike S , et al. 2004
Tac4 tachykinin 4 93670 Q99N14 ChIP
Horike S , et al. 2004
Tardbp TAR DNA binding protein 230908 Q921F2 RNA immunoprecipitation (RIP); IP; MS
Sephton CF , et al. 2010
Tardbp TAR DNA binding protein 230908 Q921F2 IP; LC-MS/MS; IP/WB
Li R , et al. 2016
Tmod3 tropomodulin 3 50875 Q9JHJ0 IP; LC-MS/MS
Li R , et al. 2016
Trp53bp1 transformation related protein 53 binding protein 1 27223 P70399 IP; LC-MS/MS
Li R , et al. 2016
Trpc3 transient receptor potential cation channel, subfamily C, member 3 22065 Q9QZC1 ChIP
Li W , et al. 2012
Tsix X (inactive)-specific transcript, antisense 22097 N/A ChIP
Son J , et al. 2012
Uba1y ubiquitin-activating enzyme, Chr Y 22202 P31254 ChIP
Horike S , et al. 2004
Uqcrc1 ubiquinol-cytochrome c reductase core protein I 22273 Q9CZ13 ChIP
Kriaucionis S , et al. 2006
Vamp7 vesicle-associated membrane protein 7 20955 P70280 ChIP
Matarazzo MR , et al. 2006
Zbtb16 zinc finger and BTB domain containing 16 235320 Q3UQ17 ChIP
Horike S , et al. 2004
Acta2 smooth muscle alpha-actin 81633 B0BMT0 EMSA; ChIP
Hu B , et al. 2011
ATRX alpha thalassemia/mental retardation syndrome X-linked 246284 P70486 Y2H
Nan X , et al. 2007
Bdnf brain-derived neurotrophic factor 24225 P23363 ChIP
Chen WG , et al. 2003
Bdnf brain-derived neurotrophic factor 24225 P23363 ChIP-qPCR
Liang Z , et al. 2015
Creb1 cAMP responsive element binding protein 1 81646 P15337 IP/WB
Tai DJ , et al. 2016
Dnmt1 DNA (cytosine-5-)-methyltransferase 1 84350 Q9Z330 IP/WB
Kimura H and Shiota K 2002
FOXG1 forkhead box G1 24370 Q00939 IP/WB
Dastidar SG , et al. 2012
Gadd45b Growth arrest and DNA-damage-inducible 45 beta 299626 Q5U3Z2 qRT-PCR; MSRE assay
Kigar SL , et al. 2015
Gfap glial fibrillary acidic protein 24387 P47819 ChIP
Setoguchi H , et al. 2006
Grin2b glutamate receptor, ionotropic, N-methyl D-aspartate 2B 24410 Q00960 ChIP
Lee S , et al. 2008
H2afx H2A histone family, member X 500987 D3ZXP3 IP/WB
Thambirajah AA , et al. 2011
H3f3b H3 histone, family 3B 117056 B0BMY8 IP/WB
Thambirajah AA , et al. 2011
Hmgb1 high-mobility group box 1 25459 P63159 GST
Dintilhac A and Bernus J 2001
Nfkbia nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha 18035 Q9Z1E3 XChIP
Mann J , et al. 2006
NLGN1 neuroligin 1 116647 Q62765 IP/WB; ChIP; Fluorescence Polarization (FP)
Bie B , et al. 2014
Pdyn prodynorphin 29190 F1M7S3 ChIP
Reed B , et al. 2012
Pias1 protein inhibitor of activated STAT, 1 300772 G3V9T0 in vitro SUMOylation assay; IP/WB; in vivo SUMOylation assay; Co-localization
Tai DJ , et al. 2016
Pparg peroxisome proliferator-activated receptor gamma 25664 O88275 ChIP
Mann J , et al. 2009
Rbpj recombination signal binding protein for immunoglobulin kappa J region 679028 N/A IP/WB
Mann J , et al. 2006
Rcor1 REST corepressor 1 314458 P49743 IP/WB
Lunyak VV , et al. 2002
Sin3a SIN3 homolog A, transcription regulator (yeast) 363067 D3ZBP2 GST; IP/WB
Nan X , et al. 1998
Suv39h1 suppressor of variegation 3-9 homolog 1 (Drosophila) 302553 B1H256 IP/WB
Lunyak VV , et al. 2002
CA2 carbonic anhydrase II 396257 P07630 ChIP
Rietveld LE , et al. 2002
gs17 gastrula-specific protein 17 397898 P07733 Methylated DNA immunoprecipitation (MeDIP); Bisulfite sequencing
Bogdanovi O and Veenstra GJ 2011
hes4-a hairy and enhancer of split 4 398579 Q90Z12 Methylated DNA immunoprecipitation (MeDIP); Bisulfite sequencing
Bogdanovi O and Veenstra GJ 2011
sin3b SIN3 homolog B, transcription regulator (yeast) 100036844 A1L1H5 IP/WB
Jones PL , et al. 1998
SOX2 Transcription factor Sox-2 398000 O42569 Antibody Microarray
Bestman JE , et al. 2015
t-a T, brachyury homolog 399275 P24781 Methylated DNA immunoprecipitation (MeDIP); Bisulfite sequencing
Bogdanovi O and Veenstra GJ 2011
tcea1 transcription elongation factor A (SII), 1 594866 Q91980 Methylated DNA immunoprecipitation (MeDIP); Bisulfite sequencing
Bogdanovi O and Veenstra GJ 2011
tfcp2 transcription factor CP2 403094 Q6NZH6 Methylated DNA immunoprecipitation (MeDIP); Bisulfite sequencing
Bogdanovi O and Veenstra GJ 2011
trim33 tripartite motif containing 33 733198 Q56R14 Methylated DNA immunoprecipitation (MeDIP); Bisulfite sequencing
Bogdanovi O and Veenstra GJ 2011
id1 inhibitor of DNA binding 1 30493 Q6IQW5 ChIP
Gao H , et al. 2015

HELP
Copyright © 2017 MindSpec, Inc.