HELP     Sign In
Search

Relevance to Autism

Mutations in the MECP2 gene underlie Rett syndrome, an autism spectrum disorder. Some studies have found that rare variations in the MECP2 gene are associated with autism, while others have looked and found no variants in autistic patients. It appears that EGR2 and MECP2 can regulate each other's expression (Swanberg et al., 2009).

Molecular Function

The encoded protein has methylation-dependent transcriptional repressor activity . It is also involved in regulation of RNA splicing.

External Links

        

References

Type
Title
Type of Disorder
Associated Disorders
Author, Year
Primary
Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2.
Rett syndrome
Positive Association
MECP2 structural and 3'-UTR variants in schizophrenia, autism and other psychiatric diseases: a possible association with autism.
ASD
SCZ
Negative Association
No mutations in the coding region of the Rett syndrome gene MECP2 in 59 autistic patients.
Rett syndrome
Support
Chromosome 2 deletion encompassing the MAP2 gene in a patient with autism and Rett-like features.
ASD
Support
Clinical and molecular genetic characterization of familial MECP2 duplication syndrome in a Chinese family.
MECP2 duplication syndrome
ASD, ID, epilepsy/seizures
Support
Deep phenotyping and whole-exome sequencing improved the diagnostic yield for nuclear pedigrees with neurodevelopmental disorders
ADHD, DD, ID
Support
Behavioral and transcriptomic analyses of mecp2 function in zebrafish
Rett syndrome
Support
Identification of Intellectual Disability Genes in Female Patients with A Skewed X Inactivation Pattern.
ID
Support
Next Generation Sequencing of 134 Children with Autism Spectrum Disorder and Regression
ASD
Developmental regression, epilepsy/seizures
Support
ASD, ID, epilepsy/seizures
Support
Rare Variant Burden and Behavioral Phenotypes in Children with Autism in Slovakia
ASD
Support
Range of genetic mutations associated with severe non-syndromic sporadic intellectual disability: an exome sequencing study.
ID
Epilepsy, ASD
Support
Elucidation of the phenotypic spectrum and genetic landscape in primary and secondary microcephaly.
Microcephaly
DD, ID
Support
Comprehensive genome sequencing analyses identify novel gene mutations and copy number variations associated with infant developmental delay or intellectual disability (DD/ID)
DD, ID
Stereotypy
Support
Genomic insights from a deeply phenotyped highly consanguineous neurodevelopmental disorders cohort
DD, epilepsy/seizures
ASD or autistic behavior, ID
Support
A mutation in the rett syndrome gene, MECP2, causes X-linked mental retardation and progressive spasticity in males.
ID
Support
Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder
ASD
Rett syndrome
Support
Report of a novel missense mutation in the MECP2 gene in a middle-aged man with intellectual disability syndrome
DD, ID, epilepsy/seizures
Support
Decoding complex inherited phenotypes in rare disorders: the DECIPHERD initiative for rare undiagnosed diseases in Chile
ASD, ID
Support
Genetic Traces in Autism Spectrum Disorders: A Whole Exome Sequencing Study from Türkiye
ASD
DD, epilepsy/seizures
Support
Effectiveness of exome and genome sequencing guided by acuity of illness for diagnosis of neurodevelopmental disorders.
ID, epilepsy
ADHD
Support
Diagnostic Yields of Trio-WES Accompanied by CNVseq for Rare Neurodevelopmental Disorders.
DD, ID
Support
Yield of Genetic Testing in Children with Autism Spectrum Disorder - A Single-Center Experience
ASD
DD, epilepsy/seizures
Support
Identification of MeCP2 mutations in a series of females with autistic disorder.
ASD
Support
Targeted sequencing and functional analysis reveal brain-size-related genes and their networks in autism spectrum disorders.
ASD
Support
Genetic care in geographically isolated small island communities: 8 years of experience in the Dutch Caribbean
DD
Support
Diagnostic findings and yield of investigations for children with developmental regression
Developmental regression
ASD, ID
Support
The MECP2 variant c.925C>T (p.Arg309Trp) causes intellectual disability in both males and females without classic features of Rett syndrome.
ID
Epilepsy/seizures
Support
Targeted re-sequencing for early diagnosis of genetic causes of childhood epilepsy: the Italian experience from the 'beyond epilepsy' project
DD, epilepsy/seizures
Autistic behavior
Support
ASD
DD, ID, epilepsy/seizures
Support
Mutation of MeCP2 at T158M Leads to Distinct Molecular and Phenotypic Abnormalities in Male and Female Mice
Rett syndrome
ASD
Support
A partial MECP2 duplication in a mildly affected adult male: a putative role for the 3' untranslated region in the MECP2 duplication phenotype.
ASD
ADHD, epilepsy
Support
Both rare and common genetic variants contribute to autism in the Faroe Islands.
ASD
Support
Impaired Neurodevelopmental Genes in Slovenian Autistic Children Elucidate the Comorbidity of Autism With Other Developmental Disorders
DD, ID
Autistic behavior, stereotypy
Support
The Genetic Puzzle of Cerebral Palsy: Results of a Monocentric Study
Cerebral palsy
DD, ID, epilepsy/seizures, stereotypy
Support
Preserved speech variant is allelic of classic Rett syndrome.
Rett syndrome
Support
Asperger syndrome and early-onset schizophrenia associated with a novel MECP2 deleterious missense variant.
ASD
SCZ
Support
Genome sequencing of 320 Chinese children with epilepsy: a clinical and molecular study
ASD, DD, epilepsy/seizures
Support
Purkinje-cell-specific MeCP2 deficiency leads to motor deficits and autistic-like behavior due to aberrations in PTP1B-TrkB-SK signaling
Rett syndrome
Support
Whole-Exome Sequencing Identifies Novel Genetic Variants Associated with Unexplained Neurodevelopmental Disorders in Children
ASD
Support
Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing.
ID
Support
The Clinical and Genetic Features of Co-occurring Epilepsy and Autism Spectrum Disorder in Chinese Children.
ASD, epilepsy/seizures
Support
Genetic variants and phenotypic data curated for the CAGI6 intellectual disability panel challenge
ID
ASD/autistic traits, epilepsy/seizures
Support
Study of MECP2 gene in Rett syndrome variants and autistic girls.
Rett syndrome
ASD
Support
Identification of autism-related MECP2 mutations by whole-exome sequencing and functional validation.
ASD
Support
Identification of Region-Specific Cytoskeletal and Molecular Alterations in Astrocytes of Mecp2 Deficient Animals
Rett syndrome
Support
The utility of exome sequencing in diagnosing pediatric neurodevelopmental disorders in a highly consanguineous population
DD
ASD, epilepsy/seizures
Support
Comprehensive molecular testing in patients with high functioning autism spectrum disorder.
ASD
Support
Next-Generation Sequencing in Korean Children With Autism Spectrum Disorder and Comorbid Epilepsy
ASD
Epilepsy/seizures, Rett syndrome
Support
DD, epilepsy/seizures
Support
Prospective study to analyze the yield and clinical impact of trio exome sequencing in 137 Indian children with autism spectrum disorder
ASD
DD
Support
Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.
ASD
Support
Inherited and multiple de novo mutations in autism/developmental delay risk genes suggest a multifactorial model.
ASD
Support
Clinical Targeted Panel Sequencing Analysis in Clinical Evaluation of Children with Autism Spectrum Disorder in China
ASD
Support
Genetic Diagnostic Yield in Autism Spectrum Disorder (ASD) and Epilepsy Phenotypes in Children with Genetically Defined ASD
ASD
ADHD, DD, ID, epilepsy/seizures
Support
Diagnostic Targeted Resequencing in 349 Patients with Drug-Resistant Pediatric Epilepsies Identifies Causative Mutations in 30 Different Genes.
Epilepsy/seizures
Rett syndrome
Support
Comorbidities associated with genetic abnormalities in children with intellectual disability
ASD, DD/ID
Support
MeCP2 represses the activity of topoisomerase IIβ in long neuronal genes
Support
Using the linear references from the pangenome to discover missing autism variants
ASD
Support
De novo mutations in schizophrenia implicate chromatin remodeling and support a genetic overlap with autism and intellectual disability.
SCZ
Support
Comprehensive Analysis of Rare Variants of 101 Autism-Linked Genes in a Hungarian Cohort of Autism Spectrum Disorder Patients.
ASD
Rett syndrome
Support
MECP2 duplication syndrome
Support
Structural variant allelic heterogeneity in MECP2 duplication syndrome provides insight into clinical severity and variability of disease expression
Lubs-type X-linked syndromic intellectual developm
Support
Neurodevelopmental disorders in males related to the gene causing Rett syndrome in females (MECP2).
ID
Support
Genomic diagnosis for children with intellectual disability and/or developmental delay.
ASD, ID, epilepsy/seizures
Support
Astrocytic Gap Junctions Contribute to Aberrant Neuronal Synchronization in a Mouse Model of MeCP2 Duplication Syndrome
MECP2 duplication syndrome
Support
Genetic and phenotypic landscape of pediatric-onset epilepsy in 142 Indian families: Counseling and therapeutic implications
Epilepsy/seizures
DD
Support
Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients.
DD, epilepsy/seizures
Developmental regression, hypotonia
Support
Phenotypic and genetic spectrum of epilepsy with myoclonic atonic seizures
ID, epilepsy/seizures
Support
Diagnostic yield of clinical exome sequencing in 868 children with neurodevelopmental disorders
Autistic behavior
DD, epilepsy/seizures, stereotypy
Support
A MECP2 missense mutation within the MBD domain in a Brazilian male with autistic disorder.
ASD
Support
Mosaic MECP2 variants in males with classical Rett syndrome features, including stereotypical hand movements.
Rett syndrome
Support
Genetic and Phenotype Analysis of a Chinese Cohort of Infants and Children With Epilepsy
Epilepsy/seizures
ASD, DD, ID
Support
Next-generation phenotyping integrated in a national framework for patients with ultrarare disorders improves genetic diagnostics and yields new molecular findings
DD
ID, epilepsy/seizures, stereotypy
Support
Clinical exome sequencing: results from 2819 samples reflecting 1000 families.
Rett syndrome
DD, ID, hypotonia
Support
De novo variants in neurodevelopmental disorders-experiences from a tertiary care center
DD, epilepsy/seizures
Support
Clinical Utility of Proband Only Clinical Exome Sequencing in Neurodevelopmental Disorders
ASD
ADHD, DD, ID, epilepsy/seizures
Support
Multilayered genetic dissection of autism: insights from whole-exome sequencing, molecular karyotyping, and cytogenetic analyses in a small Turkish cohort
ASD
Support
Using whole-exome sequencing to identify inherited causes of autism.
ASD
Support
Lessons Learned from Large-Scale, First-Tier Clinical Exome Sequencing in a Highly Consanguineous Population.
DD, ID
Epilepsy/seizures, ASD, stereotypies
Support
Unveiling genetic insights: Array-CGH and WES discoveries in a cohort of 122 children with essential autism spectrum disorder
ASD
Support
In-frame deletion in MECP2 causes mild nonspecific mental retardation.
ID
Support
Mapping autosomal recessive intellectual disability: combined microarray and exome sequencing identifies 26 novel candidate genes in 192 consanguin...
ID
Support
Autism spectrum disorder and comorbid neurodevelopmental disorders (ASD-NDDs): Clinical and genetic profile of a pediatric cohort
ASD
DD, ID, epilepsy/seizures
Support
Exome sequencing improves the molecular diagnostics of paediatric unexplained neurodevelopmental disorders
DD, ID
Support
MECP2 missense mutations outside the canonical MBD and TRD domains in males with intellectual disability.
ID
ASD
Support
Rare genetic susceptibility variants assessment in autism spectrum disorder: detection rate and practical use.
ASD
Support
Exome Study of Single Nucleotide Variations in Patients with Syndromic and Non-Syndromic Autism Reveals Potential Candidate Genes for Diagnostics and Novel Single Nucleotide Variants
ASD
DD, epilepsy/seizures
Support
A novel familial MECP2 mutation in a young boy: clinical and molecular findings.
ID
Epilepsy
Support
Diagnostic value of partial exome sequencing in developmental disorders.
DD
Support
Diagnostic yield of patients with undiagnosed intellectual disability
DD, ID
Support
The impact of inversions across 33,924 families with rare disease from a national genome sequencing project
DD, ID, epilepsy/seizures
Autistic features, stereotypy
Support
De novo genic mutations among a Chinese autism spectrum disorder cohort.
ASD
Support
Genome sequencing broadens the range of contributing variants with clinical implications in schizophrenia
SCZ
Support
Non-canonical C-terminal variant of MeCP2 R344W exhibits enhanced degradation rate
Atypcial Rett syndrome, ASD, DD
Support
Double Genetic Diagnosis Involving MECP2 and EPHB4 in a Child with Neurodevelopmental Delay and Vascular Anomalies: A Case Report
Rett syndrome, ASD, DD
Support
Rare complete knockouts in humans: population distribution and significant role in autism spectrum disorders.
ASD
Support
Neurological Diseases With Autism Spectrum Disorder: Role of ASD Risk Genes.
ASD
ID, epilepsy/seizures
Support
Aberrant brain functional and structural developments in MECP2 duplication rats
MECP2 duplication syndrome
Support
The genetic landscape of autism spectrum disorder in an ancestrally diverse cohort
ASD
Support
MECP2 is highly mutated in X-linked mental retardation.
ID
Support
Familial cases and male cases with MECP2 mutations.
Rett syndrome, X-linked intellectual disability
Support
Genetic Testing in Patients with Neurodevelopmental Disorders: Experience of 511 Patients at Cincinnati Children's Hospital Medical Center
ASD, DD
Epilepsy/seizures
Support
Whole Exome Sequencing as a First-Line Molecular Genetic Test in Developmental and Epileptic Encephalopathies
ID, epilepsy/seizures
Support
Mutations in epilepsy and intellectual disability genes in patients with features of Rett syndrome.
Rett syndrome
Epilepsy
Support
Exome sequencing of 457 autism families recruited online provides evidence for autism risk genes
ASD
Support
ASD
Support
Revealing function-altering MECP2 mutations in individuals with autism spectrum disorder using yeast and Drosophila
ASD
Support
Submicroscopic duplication in Xq28 causes increased expression of the MECP2 gene in a boy with severe mental retardation and features of Rett syndr...
ID
RTT
Support
Diagnostic exome sequencing of syndromic epilepsy patients in clinical practice.
DD, epilepsy/seizures
Support
Trio-based exome sequencing reveals a high rate of the de novo variants in intellectual disability
ID
Support
Phenotypic and genetic analysis of children with unexplained neurodevelopmental delay and neurodevelopmental comorbidities in a Chinese cohort using trio-based whole-exome sequencing
DD, ID
ASD, ADHD, epilepsy/seizures
Support
Identification of a RAI1-associated disease network through integration of exome sequencing, transcriptomics, and 3D genomics.
DD
Behavioral abnormalities (self-injurious, aggressi
Support
Graded and pan-neural disease phenotypes of Rett Syndrome linked with dosage of functional MeCP2
Support
Prospect of genetic disorders in Saudi Arabia
DD
Support
Predicting the diagnostic efficacy of trio-based whole exome sequencing in children with low-function autism spectrum disorders: a multicenter study
ASD, DD/ID
ADHD
Support
The expanding role of MBD genes in autism: identification of a MECP2 duplication and novel alterations in MBD5, MBD6, and SETDB1.
ASD
Support
The combination of whole-exome sequencing and copy number variation sequencing enables the diagnosis of rare neurological disorders.
DD, ID
ASD, epilepsy/seizures
Support
Integrating de novo and inherited variants in 42
ASD
Support
Trio-whole exome sequencing reveals the importance of de novo variants in children with intellectual disability and developmental delay
ASD, DD
Epilepsy/seizures
Support
MECP2 mutation in male patients with non-specific X-linked mental retardation.
ID
Support
A clinical utility study of exome sequencing versus conventional genetic testing in pediatric neurology.
DD
Support
Detecting cryptic clinically relevant structural variation in exome-sequencing data increases diagnostic yield for developmental disorders
DD, ID, epilepsy/seizures
Support
The developmental timing of spinal touch processing alterations predicts behavioral changes in genetic mouse models of autism spectrum disorders
ASD
Somatosensory behaviors
Support
A novel heterozygous pathogenic variation in the MECP2 gene causing typical Rett syndrome: a case report
Rett syndrome, DD
Stereotypy
Support
Large-scale discovery of novel genetic causes of developmental disorders.
DD
Stereotypic behavior
Support
Characterization of intellectual disability and autism comorbidity through gene panel sequencing.
ID, ASD or autistic traits
Support
Autistic-like behaviors and impaired chronic inflammatory pain in primary nociceptive neuron-specific deletion of Mecp2 or Fmr1 knockout male mice
ASD
Highly Cited
Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex.
Highly Cited
MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin.
Recent Recommendation
MECP2 genomic structure and function: insights from ENCODE.
Recent Recommendation
MECP2 directly interacts with RNA polymerase II to modulate transcription in human neurons
Rett syndrome
Recent Recommendation
Genome-wide activity-dependent MeCP2 phosphorylation regulates nervous system development and function.
Recent Recommendation
Activity-dependent phosphorylation of MeCP2 threonine 308 regulates interaction with NCoR.
Recent Recommendation
Deletion of Mecp2 in Sim1-expressing neurons reveals a critical role for MeCP2 in feeding behavior, aggression, and the response to stress.
Recent Recommendation
Disruption of MeCP2-TCF20 complex underlies distinct neurodevelopmental disorders
Rett syndrome
Recent Recommendation
L1 retrotransposition in neurons is modulated by MeCP2.
Recent Recommendation
Rett syndrome mutations abolish the interaction of MeCP2 with the NCoR/SMRT co-repressor.
Recent Recommendation
Genetic modifiers of MeCP2 function in Drosophila.
Recent Recommendation
Further delineation of the MECP2 duplication syndrome phenotype in 59 French male patients, with a particular focus on morphological and neurologic...
MECP2 duplication syndrome
Stereotypic movements
Recent Recommendation
Dysfunction in GABA signalling mediates autism-like stereotypies and Rett syndrome phenotypes.
Recent Recommendation
An AT-hook domain in MeCP2 determines the clinical course of Rett syndrome and related disorders.
Recent Recommendation
A MECP2 mutation in a highly conserved aminoacid causing mental retardation in a male.
ID
Recent Recommendation
GluD1 is a common altered player in neuronal differentiation from both MECP2-mutated and CDKL5-mutated iPS cells.
Recent Recommendation
Neuronal MeCP2 is expressed at near histone-octamer levels and globally alters the chromatin state.
Recent Recommendation
Bisphenol A delays the perinatal chloride shift in cortical neurons by epigenetic effects on the Kcc2 promoter.
Recent Recommendation
Increased binding of MeCP2 to the GAD1 and RELN promoters may be mediated by an enrichment of 5-hmC in autism spectrum disorder (ASD) cerebellum.
Recent Recommendation
MeCP2 deficiency disrupts axonal guidance, fasciculation, and targeting by altering Semaphorin 3F function.
Recent Recommendation
MeCP2 binds to 5hmC enriched within active genes and accessible chromatin in the nervous system.
Recent Recommendation
Oligodendrocyte lineage cells contribute unique features to Rett syndrome neuropathology.
Recent Recommendation
Reciprocal co-regulation of EGR2 and MECP2 is disrupted in Rett syndrome and autism.
ASD, RTT
Recent Recommendation
MeCP2 regulates telencephalic development in human cerebral organoids
Rett syndrome
ASD
Recent Recommendation
Overexpression of methyl-CpG binding protein 2 impairs T(H)1 responses.
Recent Recommendation
Transcriptional regulation of the MET receptor tyrosine kinase gene by MeCP2 and sex-specific expression in autism and Rett syndrome.

Rare

Variant ID
Variant Type
Allele Change
Residue Change
Inheritance Pattern
Inheritance Association
Family Type
Author, Year
 GEN157R001 
 missense_variant 
 c.397C>A 
 p.Arg133Cys 
 De novo 
  
 Simplex 
 GEN157R002 
 missense_variant 
 c.464T>C 
 p.Phe155Ser 
 De novo 
  
 Simplex 
 GEN157R003 
 missense_variant 
 c.473C>T 
 p.Thr158Met 
 De novo 
  
 Simplex 
 GEN157R004 
 stop_gained 
 c.837C>T 
  
 De novo 
  
 Simplex 
 GEN157R005 
 frameshift_variant 
 c.694insT 
 Stop after 27 out of frame AA's 
 Unknown 
 Not maternal 
 Simplex 
 GEN157R006 
 missense_variant 
 c.316C>T 
 p.Arg106Trp 
 Unknown 
 Not maternal 
 Multiplex 
 GEN157R007 
 synonymous_variant 
 c.656C>T 
 p.(=) 
 Familial 
 Paternal 
 Multiplex 
 GEN157R008 
 synonymous_variant 
 c.1307C>T 
 p.(=) 
 Unknown 
 Not maternal 
 Simplex 
 GEN157R009 
 missense_variant 
 c.1214C>T 
 p.Pro405Leu 
 De novo 
  
  
 GEN157R010 
 missense_variant 
 c.587C>G 
 p.Thr196Ser 
  
  
  
 GEN157R011 
 missense_variant 
 c.1127C>G 
 p.Pro376Arg 
  
  
  
 GEN157R012 
 frameshift_variant 
 c.1558insA 
  
  
  
  
 GEN157R013 
 missense_variant 
 c.1127C>G 
 p.Pro376Arg 
  
  
  
 GEN157R014 
 3_prime_UTR_variant 
 c.6809T>C 
  
 Familial 
 Maternal 
  
 GEN157R015 
 3_prime_UTR_variant 
 c.1638G>C 
  
 Familial 
 Maternal 
  
 GEN157R016 
 frameshift_variant 
 c.1193_1233del 
 p.Leu398HisfsTer5 
 De novo 
  
  
 GEN157R017 
 stop_gained 
 c.880C>T 
 p.Arg294Ter 
 De novo 
  
  
 GEN157R018 
 stop_gained 
 c.1216G>A 
 p.Glu406Lys 
 Familial 
 Maternal 
 Multi-generational 
 GEN157R019 
 missense_variant 
 c.419C>T 
 p.Ala140Val 
 Familial 
 Maternal 
 Multi-generational 
 GEN157R020 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
  
  
  
 GEN157R021 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
  
  
  
 GEN157R022 
 missense_variant 
 c.608C>T 
 p.Pro203Leu 
 Unknown 
  
 Unknown 
 GEN157R023 
 synonymous_variant 
 c.656C>T 
 p.(=) 
  
  
  
 GEN157R024 
 synonymous_variant 
 c.1145C>T 
 p.(=) 
  
  
  
 GEN157R025 
 intron_variant 
 IVS2-61C>G 
  
  
  
  
 GEN157R026 
 missense_variant 
 c.410A>G 
 p.Glu137Gly 
  
  
  
 GEN157R027 
 missense_variant 
 c.499C>T 
 p.Arg167Trp 
 Familial 
 Maternal 
 Multiplex 
 GEN157R028 
 missense_variant 
 c.1196C>T 
 p.Pro399Leu 
  
  
  
 GEN157R029 
 missense_variant 
 c.1358G>A 
 p.Arg453Gln 
  
  
  
 GEN157R030 
 missense_variant 
 c.850A>G 
 p.Lys284Glu 
  
  
  
 GEN157R031 
 intron_variant 
 CT>GT 
  
  
  
  
 GEN157R032 
 synonymous_variant 
 c.849C>G 
 p.(=) 
  
  
  
 GEN157R033 
 synonymous_variant 
 c.897C>T 
 p.Ala299= 
  
  
  
 GEN157R034 
 synonymous_variant 
 c.1035A>G 
 p.(=) 
  
  
  
 GEN157R035 
 synonymous_variant 
 c.1160C>T 
 p.Ser387Phe 
  
  
  
 GEN157R036 
 inframe_deletion 
 c.1161_1400del 
 p.Pro388_Glu467del 
 Familial 
 Maternal 
  
 GEN157R037 
 copy_number_gain 
  
  
 Familial 
 Maternal 
 Simplex 
 GEN157R038 
 missense_variant 
 c.674C>T 
 p.Pro225Leu 
 De novo 
  
  
 GEN157R039 
 missense_variant 
 c.964C>T 
 p.Pro322Ser 
 Familial 
 Maternal 
  
 GEN157R040 
 missense_variant 
 c.479C>G 
 p.Thr160Arg 
  
  
  
 GEN157R041 
 synonymous_variant 
 c.582C>T 
 p.(=) 
  
  
  
 GEN157R042 
 missense_variant 
 c.1189G>A 
 p.Glu397Lys 
  
  
  
 GEN157R043 
 synonymous_variant 
 c.1233C>T 
 p.Pro411= 
  
  
  
 GEN157R044 
 missense_variant 
 c.641C>G 
 p.Ala214Gly 
 Familial 
 Maternal 
 Simplex 
 GEN157R045 
 synonymous_variant 
 c.819G>T 
 p.(=) 
 Familial 
 Paternal 
  
 GEN157R046 
 copy_number_gain 
  
  
 Familial 
 Paternal 
 Multiplex 
 GEN157R047 
 missense_variant 
 c.719C>G 
 p.Thr240Ser 
 Familial 
 Maternal 
 Multiplex 
 GEN157R048 
 missense_variant 
 c.719C>G 
 p.Thr240Ser 
 Familial 
 Maternal 
 Simplex 
 GEN157R049 
 missense_variant 
 c.1108G>A 
 p.Ala370Thr 
 Familial 
 Maternal 
 Simplex 
 GEN157R050 
 intron_variant 
 c.63-44T>C 
  
 Unknown 
 Unknown 
 Unknown 
 GEN157R051 
 synonymous_variant 
 c.312A>G 
 p.Gly104= 
 Unknown 
 Unknown 
 Unknown 
 GEN157R052 
 intron_variant 
 c.413+94C>T 
  
 Unknown 
 Unknown 
 Unknown 
 GEN157R053 
 intron_variant 
 c.413+102A>G 
  
 Unknown 
 Unknown 
 Unknown 
 GEN157R054 
 synonymous_variant 
 c.786C>T 
 p.Arg262= 
 Unknown 
 Unknown 
 Unknown 
 GEN157R055 
 synonymous_variant 
 c.870C>T 
 p.Ala290= 
 Unknown 
 Unknown 
 Unknown 
 GEN157R056 
 synonymous_variant 
 c.978C>T 
 p.Ile326= 
 Unknown 
 Unknown 
 Unknown 
 GEN157R057 
 synonymous_variant 
 c.1071A>G 
 p.Lys357= 
 Unknown 
 Unknown 
 Unknown 
 GEN157R058 
 synonymous_variant 
 c.1371G>A 
 p.Thr457= 
 Unknown 
 Unknown 
 Unknown 
 GEN157R059 
 synonymous_variant 
 c.65T>C 
 p.(=) 
 Unknown 
 Unknown 
 Unknown 
 GEN157R060 
 frameshift_variant 
 c.1200_1222del 
 p.Pro401ArgfsTer8 
 De novo 
  
 Simplex 
 GEN157R061 
 missense_variant 
 c.596C>G 
 p.Pro199Arg 
 Familial 
 Maternal 
 Multiplex 
 GEN157R062 
 stop_gained 
 c.1447G>T 
 p.Glu483Ter 
 Familial 
 Maternal 
 Multiplex 
 GEN157R063 
 missense_variant 
 c.604C>T 
 p.Arg202Cys 
 De novo 
  
 Simplex 
 GEN157R064 
 missense_variant 
 c.398G>T 
 p.Arg133Leu 
 De novo 
  
 Simplex 
 GEN157R065 
 stop_gained 
 c.423C>G 
 p.Tyr141Ter 
 De novo 
  
 Simplex 
 GEN157R066 
 frameshift_variant 
 c.432del 
 p.Arg145AlafsTer6 
 De novo 
  
 Simplex 
 GEN157R067 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 De novo 
  
 Simplex 
 GEN157R068 
 missense_variant 
 c.674C>G 
 p.Pro225Arg 
 De novo 
  
 Simplex 
 GEN157R069 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 De novo 
  
 Simplex 
 GEN157R070 
 stop_gained 
 c.808C>T 
 p.Arg270Ter 
 De novo 
  
 Simplex 
 GEN157R071 
 frameshift_variant 
 c.806del 
 p.Ala269ValfsTer32 
 De novo 
  
 Simplex 
 GEN157R072 
 stop_gained 
 c.880C>T 
 p.Arg294Ter 
 De novo 
  
 Simplex 
 GEN157R073 
 frameshift_variant 
 c.1157del 
 p.Glu386GlyfsTer35 
 De novo 
  
 Simplex 
 GEN157R074 
 frameshift_variant 
 c.1158_1198del 
 p.Glu386AspfsTer5 
 De novo 
  
 Simplex 
 GEN157R075 
 frameshift_variant 
 c.1159del 
 p.Ser387ProfsTer34 
 De novo 
  
 Simplex 
 GEN157R076 
 frameshift_variant 
 c.1165_1233del69ins21 
 p.Pro389_Pro411del23ins7 
 De novo 
  
 Simplex 
 GEN157R077 
 stop_gained 
 c.1357C>T 
 p.Arg453Ter 
 De novo 
  
 Simplex 
 GEN157R078 
 missense_variant 
 c.397C>T 
 p.Arg133Cys 
 De novo 
  
 Simplex 
 GEN157R079 
 stop_gained 
 c.763C>T(c.799C>T) 
 p.Arg255Ter (p.Arg267Ter) 
 De novo 
  
 Simplex 
 GEN157R080 
 missense_variant 
 c.473C>T(c.509C>T) 
 p.Thr158Met (p.Thr170Met) 
 De novo 
  
 Simplex 
 GEN157R081 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 De novo 
  
 Simplex 
 GEN157R082 
 missense_variant 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R083 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 De novo 
  
 Simplex 
 GEN157R084a 
 complex_structural_alteration 
 c.954A>T 
 p.Glu318Asp 
 Familial 
 Maternal 
 Multi-generational 
 GEN157R084b 
 complex_structural_alteration 
 NM_004992.3:c.1097_1235delins50bp 
 p.Arg354_Val412delins41 
 Familial 
 Maternal 
 Multi-generational 
 GEN157R085 
 stop_gained 
 c.1483G>T 
 p.Glu495Ter 
 Familial 
 Maternal 
 Multiplex 
 GEN157R086 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 Unknown 
  
 Unknown 
 GEN157R087 
 missense_variant 
 c.1366G>A 
 p.Ala456Thr 
 Unknown 
  
  
 GEN157R088 
 frameshift_variant 
 c.771_814del 
 p.Met258ProfsTer70 
 De novo 
  
  
 GEN157R089 
 missense_variant 
 c.316C>T 
 p.Arg106Trp 
 De novo 
  
  
 GEN157R090 
 frameshift_variant 
 c.21del 
 p.Ala8ArgfsTer36 
 De novo 
  
  
 GEN157R091 
 missense_variant 
 c.554G>T 
 p.Gly185Val 
 Familial 
 Maternal 
 Multiplex 
 GEN157R092 
 missense_variant 
 c.499C>T 
 p.Arg167Trp 
 Familial 
 Maternal 
 Multiplex 
 GEN157R093 
 missense_variant 
 c.925C>T 
 p.Arg309Trp 
 De novo 
  
  
 GEN157R094 
 missense_variant 
 c.925C>T 
 p.Gln309Ter 
 De novo 
  
  
 GEN157R095 
 missense_variant 
 c.925C>T 
 p.Gln309Ter 
 De novo 
  
  
 GEN157R096 
 missense_variant 
 c.925C>T 
 p.Gln309Ter 
 De novo 
  
  
 GEN157R097 
 missense_variant 
 c.925C>T 
 p.Gln309Ter 
 De novo 
  
  
 GEN157R098 
 missense_variant 
 c.925C>T 
 p.Gln309Ter 
 Familial 
 Maternal 
  
 GEN157R099 
 missense_variant 
 c.419C>T 
 p.Ala140Val 
 Familial 
 Maternal 
 Multiplex 
 GEN157R100 
 stop_gained 
 c.880C>T 
 p.Arg294Ter 
 Unknown 
  
  
 GEN157R101 
 frameshift_variant 
 GGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGT>G 
 p.Pro398fsTer 
 Familial 
 Maternal 
  
 GEN157R102 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
  
 GEN157R103 
 stop_gained 
 c.799C>T 
 p.Arg267Ter 
 De novo 
  
  
 GEN157R104 
 stop_gained 
 c.538C>T 
 p.Arg180Ter 
 Unknown 
 Not maternal 
  
 GEN157R105 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R106 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R107 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 De novo 
  
  
 GEN157R108 
 copy_number_loss 
  
  
 De novo 
  
  
 GEN157R109 
 missense_variant 
 c.397C>T 
 p.Arg133Cys 
 De novo 
  
  
 GEN157R110 
 missense_variant 
 c.915G>T 
 p.Lys305Asn 
 De novo 
  
  
 GEN157R111 
 missense_variant 
 c.491G>T 
 p.Ser164Ile 
 De novo (germline mosaicism) 
  
 Multiplex (dizygotic twins) 
 GEN157R112 
 frameshift_variant 
 c.1164_1207del 
 p.Pro389Ter 
 De novo 
  
 Multiplex 
 GEN157R113 
 frameshift_variant 
 c.722dup 
 p.Pro242AlafsTer6 
 De novo 
  
 Multiplex 
 GEN157R114 
 stop_gained 
 c.1447G>T;c.1483G>T 
 p.Glu483Ter;p.Glu495Ter 
 Familial 
 Maternal 
 Multiplex 
 GEN157R115 
 stop_gained 
 c.800G>A 
 p.Arg267Gln 
 Unknown 
  
 Simplex 
 GEN157R116 
 frameshift_variant 
 c.1167_1200del 
 p.Pro390AlafsTer8 
 Unknown 
  
 Simplex 
 GEN157R117 
 copy_number_gain 
  
  
 Familial 
 Maternal 
  
 GEN157R118 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 De novo 
  
  
 GEN157R119 
 missense_variant 
 c.569G>A 
 p.Arg190His 
 Familial 
  
 Multi-generational 
 GEN157R120 
 missense_variant 
 c.397C>T 
 p.Arg133Cys 
 Familial 
 Maternal 
 Multiplex 
 GEN157R121 
 missense_variant 
 c.916C>T 
 p.Arg306Ter 
 Familial 
 Maternal 
 Multi-generational 
 GEN157R122 
 missense_variant 
 c.397C>T 
 p.Arg133Cys 
 Familial 
 Maternal 
 Multi-generational 
 GEN157R123a 
 stop_gained 
 c.1164_1207del 
 p.Lys389Ter 
 Familial 
 Maternal 
 Simplex 
 GEN157R123b 
 stop_gained 
 c.1227_1229del 
 p.Glu409del 
 Familial 
 Maternal 
 Simplex 
 GEN157R124 
 missense_variant 
 c.1409G>A 
 p.Arg470His 
 Familial 
 Maternal 
 Simplex 
 GEN157R125 
 missense_variant 
 c.441C>G 
 p.Asp147Glu 
 Familial 
 Maternal 
 Multiplex 
 GEN157R126 
 intron_variant 
 c.21C>G 
 p.Ala7= 
 De novo 
  
  
 GEN157R127 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 De novo 
  
  
 GEN157R128 
 frameshift_variant 
 c.1157_1197del 
 p.Glu386AlafsTer5 
 De novo 
  
  
 GEN157R129 
 missense_variant 
 c.455C>T 
 p.Ala152Val 
 De novo 
  
 Simplex 
 GEN157R130 
 missense_variant 
 c.1162C>T 
 p.Pro388Ser 
 Familial 
 Maternal 
 Simplex 
 GEN157R131 
 stop_gained 
 c.880C>T 
 p.Arg294Ter 
 De novo 
  
 Simplex 
 GEN157R132 
 stop_gained 
 c.844C>T 
 p.Arg282Ter 
 De novo 
  
 Simplex 
 GEN157R133 
 copy_number_gain 
  
  
 Familial 
 Maternal 
 Multi-generational 
 GEN157R134 
 copy_number_gain 
  
  
 De novo 
  
  
 GEN157R135 
 missense_variant 
 c.397C>T 
 p.Arg133Cys 
 De novo 
  
  
 GEN157R136 
 frameshift_variant 
 c.1309dup 
 p.Glu437GlyfsTer11 
 De novo 
  
  
 GEN157R137 
 stop_gained 
 c.808C>T 
 p.Arg270Ter 
 De novo 
  
  
 GEN157R138 
 stop_gained 
 c.538C>T 
 p.Arg180Ter 
 De novo 
  
 Simplex 
 GEN157R139 
 stop_gained 
 c.799C>T 
 p.Arg267Ter 
 De novo 
  
 Simplex 
 GEN157R140 
 frameshift_variant 
 c.746del 
 p.Gly249ValfsTer11 
 Familial 
 Maternal 
 Simplex 
 GEN157R141 
 stop_gained 
 c.538C>T 
 p.Arg180Ter 
 Unknown 
 Not maternal 
 Simplex 
 GEN157R142 
 missense_variant 
 c.1108G>A 
 p.Ala370Thr 
 De novo 
  
 Simplex 
 GEN157R143 
 missense_variant 
 c.307C>T 
 p.Arg103Trp 
 De novo 
  
 Simplex 
 GEN157R144 
 frameshift_variant 
 c.1138_1144del 
 p.His380ThrfsTer39 
 Familial 
 Maternal 
 Multiplex 
 GEN157R145 
 frameshift_variant 
 c.806del 
 p.Ala269ValfsTer32 
 De novo 
  
  
 GEN157R146 
 missense_variant 
 c.473C>T 
 p.Thr158Met 
 De novo 
  
 Multi-generational 
 GEN157R147 
 missense_variant 
 c.473C>T 
 p.Thr158Met 
 De novo 
  
  
 GEN157R148 
 copy_number_loss 
  
  
 De novo 
  
  
 GEN157R149 
 missense_variant 
 c.398G>A 
 p.Arg133His 
 De novo 
  
  
 GEN157R150 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
  
 GEN157R151 
 stop_gained 
 c.844C>T 
 p.Arg282Ter 
 De novo 
  
  
 GEN157R152 
 frameshift_variant 
 c.1416_1417del 
 p.Ile473CysfsTer25 
 De novo 
  
  
 GEN157R153 
 missense_variant 
 c.509C>T 
 p.Thr170Met 
 De novo 
  
  
 GEN157R154 
 missense_variant 
 c.473C>T 
 p.Thr158Met 
 De novo 
  
  
 GEN157R155 
 missense_variant 
 c.1208C>G 
 p.Pro403Arg 
 Familial 
 Maternal 
  
 GEN157R156 
 missense_variant 
 c.1216G>A 
 p.Glu406Lys 
 Familial 
 Maternal 
  
 GEN157R157 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 De novo 
  
  
 GEN157R158 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 De novo 
  
  
 GEN157R159 
 frameshift_variant 
 c.47_57del 
 p.Gly16GlufsTer22 
 Unknown 
  
  
 GEN157R160 
 missense_variant 
 c.397C>T 
 p.Arg133Cys 
 De novo 
  
  
 GEN157R161 
 missense_variant 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
  
 GEN157R162 
 missense_variant 
 c.509C>T 
 p.Thr170Met 
 De novo 
  
  
 GEN157R163 
 copy_number_gain 
  
  
 Familial 
 Maternal 
  
 GEN157R164 
 missense_variant 
 c.925C>T 
 p.Gln309Ter 
 De novo 
  
  
 GEN157R165 
 stop_gained 
 c.686C>A 
 p.Pro229His 
 De novo 
  
  
 GEN157R166 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 Unknown 
  
  
 GEN157R167 
 stop_gained 
 c.880C>T 
 p.Arg294Ter 
 De novo 
  
  
 GEN157R168 
 missense_variant 
 c.352C>T 
 p.Arg118Trp 
 Unknown 
  
 Unknown 
 GEN157R169 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 De novo 
  
 Unknown 
 GEN157R170 
 missense_variant 
 c.1104C>G 
 p.Ser368Arg 
 Unknown 
  
 Unknown 
 GEN157R171 
 stop_gained 
 c.538C>T 
 p.Arg180Ter 
 Unknown 
  
 Unknown 
 GEN157R172 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 De novo 
  
 Unknown 
 GEN157R173 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 Unknown 
  
 Unknown 
 GEN157R174 
 missense_variant 
 c.952C>T 
 p.Arg318Cys 
 Unknown 
  
 Unknown 
 GEN157R175 
 frameshift_variant 
 c.1193_1199del 
 p.Leu398HisfsTer21 
 Familial 
 Maternal 
  
 GEN157R176 
 missense_variant 
 c.845A>G 
 p.Glu282Gly 
 De novo 
  
 Simplex 
 GEN157R177 
 missense_variant 
 c.673C>A 
 p.Pro225Thr 
 De novo 
  
  
 GEN157R178 
 missense_variant 
 c.602C>T 
 p.Ala201Val 
 Unknown 
  
  
 GEN157R179 
 missense_variant 
 c.403A>G 
 p.Lys135Glu 
 Unknown 
  
  
 GEN157R180 
 missense_variant 
 c.455C>G 
 p.Pro152Arg 
 Unknown 
  
  
 GEN157R181 
 frameshift_variant 
 c.1157_1185del 
 p.Glu386AlafsTer9 
 Unknown 
  
 Unknown 
 GEN157R182 
 missense_variant 
 c.397C>T 
 p.Arg133Cys 
 Unknown 
  
 Unknown 
 GEN157R183 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 Unknown 
  
 Unknown 
 GEN157R184 
 missense_variant 
 c.439A>G 
 p.Lys147Glu 
 Unknown 
  
 Unknown 
 GEN157R185 
 frameshift_variant 
 c.1158_1164del 
 p.Ser387ArgfsTer32 
 Unknown 
  
 Unknown 
 GEN157R186 
 copy_number_gain 
  
  
 Familial 
 Maternal 
 Unknown 
 GEN157R187 
 stop_gained 
 c.820C>T 
 p.Gln274Ter 
 Unknown 
  
 Unknown 
 GEN157R188 
 stop_gained 
 c.1363G>T 
 p.Ala455Ser 
 Unknown 
  
  
 GEN157R189 
 copy_number_loss 
  
  
 De novo 
  
  
 GEN157R190 
 deletion 
  
  
 De novo 
  
  
 GEN157R191 
 delins 
  
  
 De novo 
  
  
 GEN157R192 
 deletion 
  
  
 De novo 
  
  
 GEN157R193 
 deletion 
  
  
 De novo 
  
  
 GEN157R194 
 frameshift_variant 
 c.1200_1243del 
 p.Pro401Ter 
 De novo 
  
  
 GEN157R195 
 stop_gained 
 c.1198_1239delinsTGAGGACTTGAG 
 p.Pro400_Ser413delinsTer 
 De novo 
  
  
 GEN157R196 
 translocation 
  
  
 De novo 
  
  
 GEN157R197 
 copy_number_gain 
  
  
 Unknown 
  
  
 GEN157R198 
 missense_variant 
 c.467A>G 
 p.Lys156Arg 
 Unknown 
  
  
 GEN157R199 
 missense_variant 
 c.473C>T 
 p.Thr158Met 
 Unknown 
  
  
 GEN157R200 
 missense_variant 
 c.824T>C 
 p.Val275Ala 
 Unknown 
  
  
 GEN157R201 
 5_prime_UTR_variant 
 c.-187_-186del 
  
 Unknown 
  
  
 GEN157R202 
 missense_variant 
 c.674C>G 
 p.Pro225Arg 
 Unknown 
  
  
 GEN157R203 
 missense_variant 
 c.509C>T 
 p.Thr170Met 
 De novo 
  
  
 GEN157R204 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 De novo 
  
  
 GEN157R205 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
  
 GEN157R206 
 missense_variant 
 c.509C>T 
 p.Thr170Met 
 De novo 
  
  
 GEN157R207 
 missense_variant 
 c.473C>T 
 p.Thr158Met 
 De novo 
  
  
 GEN157R208 
 missense_variant 
 c.473C>T 
 p.Thr158Met 
 De novo 
  
  
 GEN157R209 
 frameshift_variant 
 c.59_60del 
 p.Arg20ThrfsTer21 
 De novo 
  
  
 GEN157R210 
 stop_gained 
 c.844C>T 
 p.Arg282Ter 
 De novo 
  
  
 GEN157R211 
 missense_variant 
 c.1208C>G 
 p.Pro403Arg 
 Familial 
 Maternal 
  
 GEN157R212 
 frameshift_variant 
 c.1416_1417del 
 p.Ile473CysfsTer25 
 De novo 
  
  
 GEN157R213 
 missense_variant 
 c.500G>C 
 p.Arg167Pro 
 Unknown 
  
 Multiplex 
 GEN157R214 
 frameshift_variant 
 c.91del 
 p.Gln31ArgfsTer13 
 Unknown 
  
  
 GEN157R215 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 De novo 
  
 Simplex 
 GEN157R216 
 missense_variant 
 c.455C>T 
 p.Ala152Val 
 Familial 
 Maternal 
  
 GEN157R217 
 frameshift_variant 
 c.1164_1198del 
 p.Lys389ThrfsTer4 
 De novo 
  
  
 GEN157R218 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 Unknown 
  
  
 GEN157R219 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
  
 GEN157R220 
 frameshift_variant 
 c.1158_1201del 
 p.Glu386AspfsTer4 
 Unknown 
  
  
 GEN157R221 
 missense_variant 
 c.961C>T 
 p.Arg321Trp 
 De novo 
  
  
 GEN157R222 
 frameshift_variant 
 c.791del 
 p.Gly264AlafsTer37 
 De novo 
  
  
 GEN157R223 
 stop_gained 
 c.799C>T 
 p.Arg267Ter 
 Unknown 
  
  
 GEN157R224 
 missense_variant 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R225 
 missense_variant 
 c.434G>A 
 p.Arg145His 
 De novo 
  
 Simplex 
 GEN157R226 
 missense_variant 
 c.352C>T 
 p.Arg118Trp 
 De novo 
  
 Simplex 
 GEN157R227 
 missense_variant 
 c.710C>G 
 p.Pro237Arg 
 De novo 
  
  
 GEN157R228 
 missense_variant 
 c.686C>T 
 p.Pro229Leu 
 De novo 
  
  
 GEN157R229 
 stop_gained 
 c.427G>T 
 p.Ala143Ser 
 De novo 
  
  
 GEN157R230 
 missense_variant 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R231 
 missense_variant 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R232 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R233 
 stop_gained 
 c.799C>T 
 p.Arg267Ter 
 De novo 
  
 Simplex 
 GEN157R234 
 missense_variant 
 c.710C>G 
 p.Pro237Arg 
 De novo 
  
 Simplex 
 GEN157R235 
 missense_variant 
 c.710C>G 
 p.Pro237Arg 
 De novo 
  
 Simplex 
 GEN157R236 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 De novo 
  
 Simplex 
 GEN157R237 
 frameshift_variant 
 c.1164_1207del 
 p.Lys389Ter 
 De novo 
  
  
 GEN157R238 
 frameshift_variant 
 c.1136_1152del 
 p.His379LeufsTer20 
 De novo 
  
  
 GEN157R239 
 missense_variant 
 c.925C>T 
 p.Gln309Ter 
 De novo 
  
  
 GEN157R240 
 missense_variant 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
  
 GEN157R241 
 missense_variant 
 c.851C>T 
 p.Pro284Leu 
 De novo 
  
  
 GEN157R242 
 missense_variant 
 c.508A>G 
 p.Thr170Ala 
 De novo 
  
  
 GEN157R243 
 missense_variant 
 c.437C>G 
 p.Ser146Cys 
 De novo 
  
  
 GEN157R244 
 missense_variant 
 c.352C>T 
 p.Arg118Trp 
 De novo 
  
  
 GEN157R245 
 missense_variant 
 c.215G>A 
 p.Gly72Asp 
 De novo 
  
  
 GEN157R246 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R247 
 missense_variant 
 c.710C>G 
 p.Pro237Arg 
 De novo 
  
  
 GEN157R248 
 missense_variant 
 c.941C>G 
 p.Pro314Arg 
 De novo 
  
 Simplex 
 GEN157R249 
 missense_variant 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R250 
 frameshift_variant 
 c.1164_1207del 
 p.Lys389Ter 
 De novo 
  
  
 GEN157R251 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
  
 GEN157R252 
 missense_variant 
 c.509C>T 
 p.Thr170Met 
 De novo 
  
  
 GEN157R253 
 missense_variant 
 c.917G>A 
 p.Arg306Gln 
 De novo 
  
  
 GEN157R254 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
  
 GEN157R255 
 missense_variant 
 c.710C>G 
 p.Pro237Arg 
 De novo 
  
 Simplex 
 GEN157R256 
 missense_variant 
 c.952C>T 
 p.Arg318Cys 
 De novo 
  
 Simplex 
 GEN157R257 
 stop_gained 
 c.844C>T 
 p.Arg282Ter 
 De novo 
  
 Simplex 
 GEN157R258 
 missense_variant 
 c.952C>T 
 p.Arg318Cys 
 De novo 
  
 Simplex 
 GEN157R259 
 frameshift_variant 
 c.1122del 
 p.Lys375ArgfsTer46 
 Familial 
 Maternal 
 Multiplex 
 GEN157R260 
 frameshift_variant 
 c.23_27del 
 p.Ala8GlufsTer32 
 De novo 
  
 Simplex 
 GEN157R261 
 frameshift_variant 
 c.842dup 
 p.Arg282ProfsTer61 
 De novo 
  
 Simplex 
 GEN157R262 
 missense_variant 
 c.491C>G 
 p.Pro164Arg 
 De novo 
  
 Simplex 
 GEN157R263 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 De novo 
  
 Simplex 
 GEN157R264 
 stop_gained 
 c.538C>T 
 p.Arg180Ter 
 De novo 
  
 Simplex 
 GEN157R265 
 missense_variant 
 c.952C>T 
 p.Arg318Cys 
 De novo 
  
 Simplex 
 GEN157R266 
 missense_variant 
 c.910C>T 
 p.Leu313Phe 
 Unknown 
  
  
 GEN157R267 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R268 
 missense_variant 
 c.455C>T 
 p.Ala152Val 
 Unknown 
  
 Simplex 
 GEN157R269 
 frameshift_variant 
 c.148_152del 
 p.Glu50ArgfsTer5 
 Unknown 
  
 Simplex 
 GEN157R270 
 missense_variant 
 c.1376C>T 
 p.Ala459Val 
 Unknown 
  
 Simplex 
 GEN157R271 
 missense_variant 
 c.1030C>T 
 p.Arg344Trp 
 Unknown 
 Not maternal 
  
 GEN157R272 
 stop_gained 
 c.844C>T 
 p.Arg282Ter 
 De novo 
  
 Simplex 
 GEN157R273 
 missense_variant 
 c.509C>T 
 p.Thr170Met 
 Unknown 
  
 Simplex 
 GEN157R274 
 frameshift_variant 
 c.1197_1222delinsAGC 
 p.Pro400AlafsTer9 
 Unknown 
  
  
 GEN157R275 
 frameshift_variant 
 c.1233dup 
 p.Thr412HisfsTer5 
 Unknown 
  
  
 GEN157R276 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 Unknown 
  
  
 GEN157R277 
 missense_variant 
 c.724C>A 
 p.Pro242Thr 
 Familial 
 Maternal 
  
 GEN157R278 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 De novo 
  
  
 GEN157R279 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 De novo 
  
  
 GEN157R280 
 frameshift_variant 
 c.792_795del 
 p.Arg265SerfsTer35 
 De novo 
  
  
 GEN157R281 
 copy_number_loss 
  
  
 Unknown 
  
  
 GEN157R282 
 frameshift_variant 
 c.842del 
 p.Gly281AlafsTer20 
 De novo 
  
  
 GEN157R283 
 frameshift_variant 
 c.1200_1243del 
 p.Pro401Ter 
 Unknown 
  
  
 GEN157R284 
 missense_variant 
 c.916C>T 
 p.Arg306Ter 
 Unknown 
  
  
 GEN157R285 
 missense_variant 
 c.952C>T 
 p.Arg318Cys 
 Unknown 
  
  
 GEN157R286 
 splice_region_variant 
 c.378-3C>G 
 p.? 
 Unknown 
  
  
 GEN157R287 
 stop_gained 
 c.799C>T 
 p.Arg267Ter 
 Unknown 
  
  
 GEN157R288 
 missense_variant 
 c.509C>T 
 p.Thr170Met 
 Unknown 
  
  
 GEN157R289 
 missense_variant 
 c.1922A>T 
 p.Asp641Val 
 Unknown 
  
  
 GEN157R290 
 missense_variant 
 c.491C>G 
 p.Pro164Arg 
 Unknown 
  
  
 GEN157R291 
 frameshift_variant 
 c.1265dup 
 p.Ser422ArgfsTer26 
 De novo 
  
 Simplex 
 GEN157R292 
 frameshift_variant 
 c.281_284dup 
 p.Arg96ThrfsTer8 
 De novo 
  
 Simplex 
 GEN157R293 
 missense_variant 
 c.952C>T 
 p.Arg318Cys 
 De novo 
  
 Simplex 
 GEN157R294 
 stop_gained 
 c.844C>T 
 p.Arg282Ter 
 De novo 
  
 Simplex 
 GEN157R295a 
 inversion 
  
  
 Familial 
 Maternal 
 Simplex 
 GEN157R295b 
 copy_number_loss 
  
  
 Familial 
 Maternal 
 Simplex 
 GEN157R295c 
 copy_number_gain 
  
  
 Familial 
 Maternal 
 Simplex 
 GEN157R296 
 inversion 
  
  
 De novo 
  
 Simplex 
 GEN157R297 
 missense_variant 
 c.397C>T 
 p.Arg133Cys 
 Unknown 
  
  
 GEN157R298 
 stop_gained 
 c.808C>T 
 p.Arg270Ter 
 De novo 
  
  
 GEN157R299 
 stop_gained 
 c.880C>T 
 p.Arg294Ter 
 De novo 
  
  
 GEN157R300 
 frameshift_variant 
 c.1152_1155del 
 p.His384GlnfsTer36 
 Unknown 
  
  
 GEN157R301 
 frameshift_variant 
 c.1152_1155del 
 p.His384GlnfsTer36 
 Unknown 
  
  
 GEN157R302 
 missense_variant 
 c.316C>T 
 p.Arg106Trp 
 De novo 
  
  
 GEN157R303 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 De novo 
  
  
 GEN157R304 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 Unknown 
  
  
 GEN157R305 
 splice_site_variant 
 c.26+2T>G 
  
 Unknown 
  
  
 GEN157R306 
 stop_gained 
 c.1164_1207del 
 p.Pro389Ter 
 Unknown 
  
  
 GEN157R307 
 missense_variant 
 c.419C>T 
 p.Ala140Val 
 Unknown 
  
  
 GEN157R308 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 De novo 
  
  
 GEN157R309 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 De novo 
  
  
 GEN157R310 
 missense_variant 
 c.473C>T 
 p.Thr158Met 
 De novo 
  
  
 GEN157R311 
 stop_gained 
 c.880C>T 
 p.Arg294Ter 
 De novo 
  
  
 GEN157R312 
 stop_gained 
 c.808C>T 
 p.Arg270Ter 
 De novo 
  
  
 GEN157R313 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 De novo 
  
  
 GEN157R314 
 stop_gained 
 c.502C>T 
 p.Arg168Ter 
 De novo 
  
  
 GEN157R315 
 frameshift_variant 
 c.1080_1194delins60 
 p.Pro362fs 
 De novo 
  
  
 GEN157R316 
 missense_variant 
 c.140C>T 
 p.Ala47Val 
 Unknown 
  
  
 GEN157R317 
 missense_variant 
 c.194C>T 
 p.Thr65Met 
 Unknown 
  
  
 GEN157R318 
 missense_variant 
 c.25C>G 
 p.Pro9Ala 
 Unknown 
  
  
 GEN157R319 
 stop_gained 
 c.223C>T 
 p.Arg75Ter 
 Unknown 
  
  
 GEN157R320 
 missense_variant 
 c.517A>G 
 p.Lys173Glu 
 Unknown 
  
  
 GEN157R321 
 stop_gained 
 c.529C>T 
 p.Arg177Ter 
 Unknown 
  
  
 GEN157R322 
 missense_variant 
 c.710C>G 
 p.Pro237Arg 
 De novo 
  
 Simplex 
 GEN157R323 
 missense_variant 
 c.504C>G 
 p.Asp168Glu 
 De novo 
  
 Simplex 
 GEN157R324 
 frameshift_variant 
 c.1225_1226del 
 p.Ser409GlnfsTer26 
 De novo 
  
 Simplex 
 GEN157R325 
 stop_gained 
 c.538C>T 
 p.Arg180Ter 
 De novo 
  
 Simplex 
 GEN157R326 
 missense_variant 
 c.952C>T 
 p.Arg318Cys 
 De novo 
  
 Simplex 
 GEN157R327 
 missense_variant 
 c.1409G>A 
 p.Arg470His 
 Familial 
 Maternal 
 Simplex 
 GEN157R328 
 missense_variant 
 c.1160C>T 
 p.Pro387Leu 
 Familial 
 Maternal 
  
 GEN157R329 
 stop_gained 
 c.808C>T 
 p.Arg270Ter 
 Unknown 
  
  
 GEN157R330 
 missense_variant 
 c.509C>T 
 p.Thr170Met 
 De novo 
  
  
 GEN157R331 
 stop_gained 
 c.538C>T 
 p.Arg180Ter 
 Unknown 
  
  
 GEN157R332 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 Unknown 
  
  
 GEN157R333 
 stop_gained 
 c.538C>T 
 p.Arg180Ter 
 Unknown 
  
  
 GEN157R334 
 stop_gained 
 c.808C>T 
 p.Arg270Ter 
 De novo 
  
 Simplex 
 GEN157R335 
 stop_gained 
 c.808C>T 
 p.Arg270Ter 
 Unknown 
  
 Simplex 
 GEN157R336 
 stop_gained 
 c.763C>T 
 p.Arg255Ter 
 Unknown 
  
 Simplex 
 GEN157R337 
 missense_variant 
 c.473C>T 
 p.Thr158Met 
 Unknown 
  
 Simplex 
 GEN157R338 
 missense_variant 
 c.316C>T 
 p.Arg106Trp 
 Unknown 
  
 Simplex 
 GEN157R339 
 missense_variant 
 c.1231A>G 
 p.Ser411Gly 
 Familial 
 Maternal 
 Unknown 
 GEN157R340 
 stop_gained 
 c.1208dup 
 p.Glu404Ter 
 Familial 
 Maternal 
  
 GEN157R341 
 missense_variant 
 c.509C>T 
 p.Thr170Met 
 De novo 
  
  
 GEN157R342 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 De novo 
  
  
 GEN157R343 
 missense_variant 
 c.434G>C 
 p.Arg145Pro 
 De novo 
  
 Simplex 
 GEN157R344 
 stop_gained 
 c.538C>T 
 p.Arg180Ter 
 De novo 
  
  
 GEN157R345 
 missense_variant 
 c.908C>G 
 p.Ser303Cys 
 Unknown 
  
  
 GEN157R346 
 missense_variant 
 c.433C>T 
 p.Arg145Cys 
 De novo 
  
 Simplex 
 GEN157R347 
 stop_lost 
 c.1081_*457del 
  
 De novo 
  
 Simplex 
 GEN157R348 
 missense_variant 
 c.952C>T 
 p.Arg318Cys 
 De novo 
  
 Simplex 
 GEN157R349 
 missense_variant 
 c.1271T>C 
 p.Val424Ala 
 Familial 
 Maternal 
 Simplex 
 GEN157R350 
 frameshift_variant 
 c.1174_1192del 
 p.Val392CysfsTer23 
 Unknown 
  
  
 GEN157R351 
 missense_variant 
 c.524G>A 
 p.Gly175Glu 
 De novo 
  
 Simplex 
 GEN157R352 
 stop_gained 
 c.916C>T 
 p.Arg306Ter 
 De novo 
  
 Simplex 
 GEN157R353 
 frameshift_variant 
 c.44_45insCGAGG 
 p.Gly16GlufsTer30 
 De novo 
  
 Simplex 

Common

No Common Variants Available
Chromosome
CNV Locus
CNV Type
# of studies
Animal Model
X
Deletion
 1
 
X
Duplication
 1
 
X
Deletion-Duplication
 22
 
X
Deletion
 2
 
X
Deletion
 1
 
X
Deletion
 2
 
X
Deletion-Duplication
 1
 
X
Deletion
 2
 
X
Deletion-Duplication
 1
 
X
Deletion
 12
 
X
Deletion-Duplication
 83
 

Model Summary

Mecp2 duplication caused intellectual disability and autism; restoration of MeCP2 copy number in the adult abrogates the symptoms of autism.

References

Type
Title
Author, Year
Rett Syndrome
A mouse Mecp2-null mutation causes neurological symptoms that mimic Rett syndrome.
Rett Syndrome
Deficiency of methyl-CpG binding protein-2 in CNS neurons results in a Rett-like phenotype in mice.
ASD
Mild overexpression of MeCP2 causes a progressive neurological disorder in mice.
Rett Syndrome
Delayed maturation of neuronal architecture and synaptogenesis in cerebral cortex of Mecp2-deficient mice.
Rett Syndrome
Mecp2 deficiency is associated with learning and cognitive deficits and altered gene activity in the hippocampal region of mice.
Rett Syndrome
Brain-derived neurotrophic factor expression and respiratory function improve after ampakine treatment in a mouse model of Rett syndrome.
Phosphorylation of MeCP2 at Serine 80 regulates its chromatin association and neurological function.
Synaptic circuit abnormalities of motor-frontal layer 2/3 pyramidal neurons in an RNA interference model of methyl-CpG-binding protein 2 deficiency.
Rett Syndrome
Progressive noradrenergic deficits in the locus coeruleus of Mecp2 deficient mice.
Loss of MeCP2 in aminergic neurons causes cell-autonomous defects in neurotransmitter synthesis and specific behavioral abnormalities.
Synaptic circuit abnormalities of motor-frontal layer 2/3 pyramidal neurons in a mutant mouse model of Rett syndrome.
Rett Syndrome, X-linked MR
Abnormalities of cell packing density and dendritic complexity in the MeCP2 A140V mouse model of Rett syndrome/X-linked mental retardation.
Rett Syndrome
Exogenous brain-derived neurotrophic factor rescues synaptic dysfunction in Mecp2-null mice.
Dysfunction in GABA signalling mediates autism-like stereotypies and Rett syndrome phenotypes.
Rett Syndrome
Rett syndrome mutation MeCP2 T158A disrupts DNA binding, protein stability and ERP responses.
Modification of Mecp2 dosage alters axonal transport through the Huntingtin/Hap1 pathway.
Pharmacological interference with the glucocorticoid system influences symptoms and lifespan in a mouse model of Rett syndrome.
7,8-dihydroxyflavone exhibits therapeutic efficacy in a mouse model of Rett syndrome.
ASD
Crh and Oprm1 mediate anxiety-related behavior and social approach in a mouse model of MECP2 duplication syndrome.
Crh and Oprm1 mediate anxiety-related behavior and social approach in a mouse model of MECP2 duplication syndrome.
MeCP2 mouse model of RTT reproduces auditory phenotypes associated with Rett syndrome and replicate select EEG endophenotypes of autism spectrum...
Long-lived epigenetic interactions between perinatal PBDE exposure and Mecp2308 mutation.
A mouse model for MeCP2 duplication syndrome: MeCP2 overexpression impairs learning and memory and synaptic transmission.
Female Mecp2() mice display robust behavioral deficits on two different genetic backgrounds providing a framework for pre-clinical studies.
Acetyl-L-carnitine improves behavior and dendritic morphology in a mouse model of Rett syndrome.
Rett syndrome, ASD, juvenile-onset schizophrenia
Sensory integration in mouse insular cortex reflects GABA circuit maturation.
ASD
Loss of MeCP2 in Parvalbumin-and Somatostatin-Expressing Neurons in Mice Leads to Distinct Rett Syndrome-like Phenotypes.
ASD
Reversal of phenotypes in MECP2 duplication mice using genetic rescue or antisense oligonucleotides.
ASD
Peripheral Mechanosensory Neuron Dysfunction Underlies Tactile and Behavioral Deficits in Mouse Models of ASDs.
Rett Syndrome
Peripheral Mechanosensory Neuron Dysfunction Underlies Tactile and Behavioral Deficits in Mouse Models of ASDs.
Rett Syndrome
D-cycloserine improves synaptic transmission in an animal mode of Rett syndrome.
Rett syndrome
Radically truncated MeCP2 rescues Rett syndrome-like neurological defects.
Additional
Striatal Inhibition of MeCP2 or TSC1 Produces Sociability Deficits and Repetitive Behaviors.
Additional
Targeting Peripheral Somatosensory Neurons to Improve Tactile-Related Phenotypes in ASD Models.
Additional
Locus-specific DNA Methylation of Mecp2 Promoter Leads to Autism-Like Phenotypes in Mice
Additional
Presymptomatic training mitigates functional deficits in a mouse model of Rett syndrome
Additional
Inhibition of Elevated Ras-MAPK Signaling Normalizes Enhanced Motor Learning and Excessive Clustered Dendritic Spine Stabilization in the MECP2-Duplication Syndrome Mouse Model of Autism
Additional
The developmental timing of spinal touch processing alterations predicts behavioral changes in genetic mouse models of autism spectrum disorders

M_MECP2_5.12_CKO_HE

Model Type: Genetic
Model Genotype: Homozygous
Mutation: Conditional deletion of exon 3- 4 of the Mecp2 gene in male mice, using Nestin-cre, in neuronal, glial and other cell types in the central and peripheral nervous system
Allele Type: Conditional loss-of-function
Strain of Origin: C57BL/6J
Genetic Background: Not Specified
ES Cell Line: E14 TG2a
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_5_KO_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Targeted Cre-loxP mediated deletion of exons 3 and 4 of Mecp2 gene.
Allele Type: Knockout
Strain of Origin: 129P2/OlaHsd
Genetic Background: C57BL/6*129P2/OlaHsd
ES Cell Line: E14 TG2a
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_5_KO_HT

Model Type: Genetic
Model Genotype: Heterozygous
Mutation: Targeted Cre-loxP mediated deletion of exons 3 and 4 of Mecp2 gene.
Allele Type: Knockout
Strain of Origin: C57BL/6J
Genetic Background: Not Specified
ES Cell Line: E14 TG2a
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_1.4_CKO_HE

Model Type: Genetic
Model Genotype: Homozygous
Mutation: Conditional deletion of exon 3, which encodes most of the methyl-CpG-binding domain of Mecp2 using the CamkII-cre, in excitatory neurons of the forebrain, in male mice
Allele Type: Conditional loss-of-function
Strain of Origin: 129/Sv
Genetic Background: Not Specified
ES Cell Line: 129/Sv, B6129F1
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_1_CKO_HE

Model Type: Genetic
Model Genotype: Homozygous
Mutation: Conditional deletion of exon 3 which encodes most of the methyl-CpG-binding domain of Mecp2 using Nestin-cre, in neuronal, glial and other cell types in the central and peripheral nervous system, in male mice
Allele Type: Conditional loss-of-function
Strain of Origin: 129/Sv
Genetic Background: Not Specified
ES Cell Line: 129/Sv, B6129F1
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_1_KO_HE

Model Type: Genetic
Model Genotype: Homozygous
Mutation: Targeting construct deletion of exon 3, which encodes most of the methyl-CpG-binding domain using the cre-loxP recombination system.
Allele Type: Knockout
Strain of Origin: 129/Sv
Genetic Background: Not Specified
ES Cell Line: 129/Sv, B6129F1
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_34_TG_2X

Model Type: Genetic
Model Genotype: Transgenic
Mutation: Mouse strain carrying human MECP2 transgene on an inbred FVB/N background; MECP2-TG mice harbor a ~99 kb P1 artificial chromosome (PAC 671D9) containing only the human MECP2 genomic locus;.
Allele Type: Transgenic
Strain of Origin: FVB/N
Genetic Background: FVB/N
ES Cell Line: FVB
Mutant ES Cell Line: Not Specified
Model Source: Zoghbi laboratory

M_MECP2_36_TG_7X

Model Type: Genetic
Model Genotype: Transgenic
Mutation: Mouse strain carrying human MECP2 transgene on a pure background (FVB/N , the trangene expression is approximately 7 fold of endogenous levels.
Allele Type: Transgenic
Strain of Origin:
Genetic Background: FVB/N
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: Taconic Farms

M_MECP2_5.2_KO_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Targeted Cre-loxP mediated deletion of exons 3 and 4 of Mecp2 gene.
Allele Type: Knockout
Strain of Origin: C57BL/6J
Genetic Background: Not Specified
ES Cell Line: E14 TG2a
Mutant ES Cell Line: Not Specified
Model Source: Jackson Laboratory

M_MECP2_11_KO_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Targeted deletion of the methyl-CpG-binding domain(MBD) coding region on exon 3 and first 170 bp of exon 4 and disruption of mRNA splicing in the Mecp2 gene.
Allele Type: Knockout
Strain of Origin: Not Specified
Genetic Background: 129 and 129xC57BL6
ES Cell Line: R1 129
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_1.2_KO_HE

Model Type: Genetic
Model Genotype: Homozygous
Mutation: Targeting construct deletion of exon 3, which encodes most of the methyl-CpG-binding domain using the cre-loxP recombination system.
Allele Type: Knockout
Strain of Origin: (C57BL/6 x 129S4/SvJae)F1
Genetic Background: 129Sv*C57BL/6*BALB/c
ES Cell Line: v6.5
Mutant ES Cell Line:
Model Source: MMRRC

M_MECP2_7_KI_HE_S80A

Model Type: Genetic
Model Genotype: Homozygous
Mutation: Knock in of mutation of serine at position 80 to alanine in exon 3 of Mecp2 gene.
Allele Type: LOF knockin
Strain of Origin: C57/B6
Genetic Background: Not Specified
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_8_CKD_HM_PYRAMIDALN-L2-3

Model Type: Genetic
Model Genotype: Homozygous
Mutation: in utero transfection of short hairpin RNA mediated knock down of MeCP2 expression in a sparsely distributed subset of layer (L) 2/3 pyramidal neurons.
Allele Type: Knockdown
Strain of Origin: C57BL/6J
Genetic Background: Not Specified
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_1.2_CKO_HE

Model Type: Genetic
Model Genotype: Homozygous
Mutation: Conditional deletion of exon 3 which encodes most of the methyl-CpG-binding domain of the Mecp2 gene , using TH-cre, in dopaminergic and noradrenergic neurons of the substantia nigra/ventral tegmental area, locus ceruleus, medullary regions as well as in the peripheral nervous system and the adrenal medulla starting around E14.5 and expressed through adulthood in some regions, in male mice
Allele Type: Conditional loss-of-function
Strain of Origin: FVB/N
Genetic Background: Not Specified
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_1.3_CKO_HE

Model Type: Genetic
Model Genotype: Homozygous
Mutation: Conditional deletion of exon 3 which encodes most of the methyl-CpG-binding domain of the Mecp2 gene using PET1-cre, in serotonergic neurons starting E10 and persisting through adulthood, in male mice
Allele Type: Conditional loss-of-function
Strain of Origin: C56BL/6J
Genetic Background: Not Specified
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_14_KI_HE_A140V

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Targeted point mutation at nucleotide position 601 from a C to T resulting in the A140V missense mutation of Mecp2.
Allele Type: NDD LOF
Strain of Origin: 129S1/X1
Genetic Background: Not Specified
ES Cell Line: R1
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_14_KI_HT_A140V

Model Type: Genetic
Model Genotype: Heterozygous
Mutation: Targeted point mutation at nucleotide position 601 from a C to T resulting in the A140V missense mutation of Mecp2.
Allele Type: NDD LOF
Strain of Origin: 129S1/X1
Genetic Background: Not Specified
ES Cell Line: R1
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_5.7_CKO_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Conditional deletion of exon 3- 4 of the Mecp2 gene in male mice, using Dlx5/6-Cre, in gabaergic neurons of the forebrain and other brain regions
Allele Type: Conditional loss-of-function
Strain of Origin: Not Specified
Genetic Background: Not Specified
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_5.8_CKO_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Conditional deletion of exons 3-4 of Mecp2 gene in male mice, using CamkII-cre, in excitatory neurons of the forebrain
Allele Type: Conditional loss-of-function
Strain of Origin: Not Specified
Genetic Background: Not Specified
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_5.9_CKO_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Conditional deletion of exon 3- 4 of the Mecp2 gene in male mice, using Viaat-cre in GABAergic neurons in the CNS
Allele Type: Conditional loss-of-function
Strain of Origin: Not Specified
Genetic Background: Not Specified
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_20_KI_HE_T158A

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Knock in of mutation of threonine at position 158 to alanine using QuickChange site-directed mutagenesis.
Allele Type: NDD knockin
Strain of Origin: Not Specified
Genetic Background: sv129:C57BL/6
ES Cell Line: sv129
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_20_KI_HT_T158A

Model Type: Genetic
Model Genotype: Heterozygous
Mutation: Knock in of mutation of threonine at position 158 to alanine using QuickChange site-directed mutagenesis.
Allele Type: LOF knockin
Strain of Origin: Not Specified
Genetic Background: sv129:C57BL/6
ES Cell Line: sv129
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_5.2_KO_HE_CORTISONE-H

Model Type: Multifactorial
Model Genotype: Hemizygous
Mutation: Targeted Cre-loxP mediated deletion of exons 3 and 4 of Mecp2 gene followed by administration of 100 microg/ml of corticosterone in drinking water from 3 weeks of age.
Allele Type: Knockout
Strain of Origin: Not specified
Genetic Background: C57BL/6
ES Cell Line: Not specified
Mutant ES Cell Line: Not specified
Model Source: Not specified

M_MECP2_5.2_KO_HE_CORTISONE-L

Model Type: Multifactorial
Model Genotype: Hemizygous
Mutation: Targeted Cre-loxP mediated deletion of exons 3 and 4 of Mecp2 gene followed by administration of 10 microg/ml of corticosterone in drinking water from 3 weeks of age.
Allele Type: Knockout
Strain of Origin: Not specified
Genetic Background: C57BL/6
ES Cell Line: Not specified
Mutant ES Cell Line: Not specified
Model Source: Not specified

M_MECP2_5.2_KO_HT_CORTISONE-H

Model Type: Multifactorial
Model Genotype: Hemizygous
Mutation: Targeted Cre-loxP mediated deletion of exons 3 and 4 of Mecp2 gene followed by administration of 100 microg/ml of corticosterone in drinking water from 3 weeks of age.
Allele Type: Knockout
Strain of Origin: Not specified
Genetic Background: C57BL/6
ES Cell Line: Not specified
Mutant ES Cell Line: Not specified
Model Source: Not specified

M_MECP2_5.2_KO_HT_CORTISONE-L

Model Type: Multifactorial
Model Genotype: Hemizygous
Mutation: Targeted Cre-loxP mediated deletion of exons 3 and 4 of Mecp2 gene followed by administration of 10 microg/ml of corticosterone in drinking water from 3 weeks of age.
Allele Type: Knockout
Strain of Origin: Not specified
Genetic Background: C57BL/6
ES Cell Line: Not specified
Mutant ES Cell Line: Not specified
Model Source: Not specified

M_MECP2_1.3_KO_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Targeting construct deletion of exon 3, which encodes most of the methyl-CpG-binding domain using the cre-loxP recombination system (Mecp2tm1.1Jae/y mice).
Allele Type: Knockout
Strain of Origin: 129/Sv
Genetic Background: C57Bl/6J
ES Cell Line:
Mutant ES Cell Line:
Model Source: Jaenisch laboratory, MIT (PMID 11242118)

M_MECP2_34.1_TG_2X

Model Type: Genetic
Model Genotype: Transgenic
Mutation: Mouse strain carrying human MECP2 transgene on a hybrid background (FVB/N x C57Bl/6).
Allele Type: Transgenic
Strain of Origin: FVB/N
Genetic Background: FVB/N x129S6Sv/Ev
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: MMRRC

M_MECP2_34.2_TG_2X

Model Type: Genetic
Model Genotype: Transgenic
Mutation: Mouse strain carrying human MECP2 transgene on a hybrid background (FVB/N x C57Bl/6).
Allele Type: Transgenic
Strain of Origin: FVB/N
Genetic Background: (FVB/N*C57Bl/6)
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: PMID 22231481

M_MECP2_36.1_TG_7X

Model Type: Genetic
Model Genotype: Transgenic
Mutation: Mouse strain carrying human MECP2 transgene on a hybrid background (FVB/N x 129S6/SvEv), the trangene expression is approximately 7 fold of endogenous levels assessed in the original article they were generated ( same construct is indicated as greater than 3 fold Mecp2 protein in PMID 22231481) .
Allele Type: Transgenic
Strain of Origin: FVB/N
Genetic Background: FVB/N x 129S6/SvEv
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: PMID 22231481

M_MECP2_36.2_TG_7X

Model Type: Genetic
Model Genotype: Transgenic
Mutation: Mouse strain carrying human MECP2 transgene on a hybrid background (C57Bl/6 * 129S6/SvEv), the trangene expression is approximately 7 fold of endogenous levels of endogenous levels assessed in the original article they were generated ( same construct is indicated as greater than 3 fold Mecp2 protein in PMID 22231481) .
Allele Type: Transgenic
Strain of Origin: FVB/N
Genetic Background: C57Bl/6 x 129S6/SvEv
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: PMID 22231481

M_MECP2_23_KI_HT_TRUNC(308)_BDE47

Model Type: Multifactorial
Model Genotype: Heterozygous
Mutation: Gene targeting to introduce a premature stop codon after codon 308 to produce truncated MeCP2 protein followed by oral administration of 0.03 mg BDE-47/kg/day for 10 weeks from preconception to lactation.
Allele Type: LOF knockin
Strain of Origin: Not Specified
Genetic Background: C57BL/6
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_4_KI_HE_TRUNC(308)

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Gene targeting to introduce a premature stop codon after codon 308 to produce truncated MeCP2 protein.
Allele Type: LOF knockin
Strain of Origin: Not Specified
Genetic Background: C57BL/6
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_4_KI_HT_TRUNC(308)

Model Type: Genetic
Model Genotype: Heterozygous
Mutation: Gene targeting to introduce a premature stop codon after codon 308 to produce truncated MeCP2 protein.
Allele Type: LOF knockin
Strain of Origin: Not Specified
Genetic Background: C57BL/6
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_26_OE_HE_NEURON-WB

Model Type: Genetic
Model Genotype: Homozygous
Mutation: Targeted Mecp2 expression in postmitotic neurons by placing it under the control of microtubulue-binding protein Tau.
Allele Type: Overexpression
Strain of Origin: Not specified
Genetic Background: Not specified
ES Cell Line: Not specified
Mutant ES Cell Line: Not specified
Model Source: Not specified

M_MECP2_5.3_KO_HT

Model Type: Genetic
Model Genotype: Heterozygous
Mutation: Targeted Cre-loxP mediated deletion of exons 3 and 4 of Mecp2 gene.
Allele Type: Knockout
Strain of Origin: Not specified
Genetic Background: FVB/N X 129S6/SvEv
ES Cell Line: Not specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_5.4_KO_HT

Model Type: Genetic
Model Genotype: Heterozygous
Mutation: Targeted Cre-loxP mediated deletion of exons 3 and 4 of Mecp2 gene.
Allele Type: Knockout
Strain of Origin: Not specified
Genetic Background: 129S6/SvEv x C57BL/6
ES Cell Line: Not specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_1.3_KO_HT

Model Type: Genetic
Model Genotype: Heterozygous
Mutation: Targeting construct deletion of exon 3, which encodes most of the methyl-CpG-binding domain using the cre-loxP recombination system.
Allele Type: Knockout
Strain of Origin: Not specified
Genetic Background: C57BL/6
ES Cell Line: Not specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MECP2_5.5_CKO_HE_PVALBN

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Conditional deletion of exon 3- 4 of Mecp2 in male mice using Pvalb-Cre, in parvalbumin expressing interneurons . Note that phenotypes of these mice are annotated in comparison to the homozygous floxed Mecp2 mice which express a truncated form of the protein
Allele Type: Conditional loss-of-function
Strain of Origin: C57Bl/6 * B6C3H
Genetic Background:
ES Cell Line:
Mutant ES Cell Line:
Model Source:

M_MECP2_5.6_CKO_HE_SSTN

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Conditional deletion of exon 3-4 of Mecp2 in male mice using SOM-Cre, in somatostatin expressing interneurons. Note that phenotypes of these mice are annotated in comparison to the homozygous floxed Mecp2 mice which express a truncated form of the protein
Allele Type: Conditional loss-of-function
Strain of Origin: C57Bl/6*129
Genetic Background:
ES Cell Line:
Mutant ES Cell Line:
Model Source:

M_MECP2_39_KI_HE_R306C

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: The point mutation R306C found in 5% of Rhett syndrome patients, was introduced in a Mecp2-EGFP targeting vector containing exon3 and part of exon4 followed by a loxP flanked neoSTOP cassette as a selectable marker; linearized vector was electroporated into 129/OlaE14 TG2a ES cells and chimeric mice generated by standard procedures. The loxP flanked neo cassette was removed by crossing to pCAGGS-cre mice, In the article by Orefice et al it is unclear if the EGFP tagged or tag-removed Mecp2 R306C mice were used.
Allele Type: LOF knockin
Strain of Origin: 129 Ola
Genetic Background: C57BL/6
ES Cell Line: 129/Ola E14 TG2a
Mutant ES Cell Line:
Model Source: PMID 23770565

M_MECP2_40_KI_HE_STOP

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Mecp2 STOP mice allow for reversible inactivation of the Mecp2 gene, these were generated by using a targeting vector with a 3.1 kb DNA fragment containing a loxP -flanked neoSTOP cassette composed of 550 bp of 3' seq S cerevisiae HIs3 gene, SV40 poly A sequence and a synthetic sequence containing a false translation initiation codon and a consensus splice donor sequence. These mice have no detectable protein detectable by western blot.
Allele Type: LOF knockin
Strain of Origin:
Genetic Background: 129/SvEv * C57BL/6J
ES Cell Line:
Mutant ES Cell Line:
Model Source:

M_MECP2_5.11_CKO_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Conditional deletion of exon 3- 4 of the Mecp2 gene in male, mice using Emx1 Cre, in the neurons and glia of the neocortex, hippocampus and pallium starting E10.5
Allele Type: Conditional loss-of-function
Strain of Origin:
Genetic Background: 129/SvEv * C57BL/6J
ES Cell Line:
Mutant ES Cell Line:
Model Source:

M_MECP2_5.13_CKO_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Conditional deletion of exon 3- 4 of the Mecp2 gene in male mice, using Advillin-creERT2, in dorsal root ganglion and trigeminal somatosensory neurons (primary somatosensory neurons) after administration of tamoxifen to male mice for 5 days starting at P28. Authors state that Mecp2 protein is deleted from 90% of DRG neurons whereas expression in the spinal cord and brain remain normal.
Allele Type: Conditional loss-of-function
Strain of Origin:
Genetic Background: 129/SvEv * C57BL/6J
ES Cell Line:
Mutant ES Cell Line:
Model Source:

M_MECP2_5.13_CKO_HT

Model Type: Genetic
Model Genotype: Heterozygous
Mutation: Conditional heterozygous deletion of exon 3- 4 of the Mecp2 gene in female mice, using Advillin-creERT2, in dorsal root ganglion and trigeminal somatosensory neurons (primary somatosensory neurons) after administration of tamoxifen to female mice for 5 days starting at P28. Authors state that Mecp2 protein is deleted from 90% of DRG neurons whereas expression in the spinal cord and brain remain normal.
Allele Type: Conditional loss-of-function
Strain of Origin:
Genetic Background: 129/SvEv * C57BL/6J
ES Cell Line:
Mutant ES Cell Line:
Model Source:

M_MECP2_5.14_CKO_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Conditional deletion of exon 3- 4 of the Mecp2 gene in male mice, using Cdx-cre, in all cells caudal to cervical level 2 leading to loss of Mecp2 protein from the DRG and spinal cord
Allele Type: Conditional loss-of-function
Strain of Origin:
Genetic Background: 129/SvEv * C57BL/6J
ES Cell Line:
Mutant ES Cell Line:
Model Source:

M_MECP2_5.15_CKO_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Conditional deletion of exon 3- 4 of the Mecp2 gene in male mice, using Advillin-cre, in dorsal root ganglion and trigeminal somatosensory neurons, while Mecp2 expression is preserved in the spinal cord (males)
Allele Type: Conditional loss-of-function
Strain of Origin:
Genetic Background: 129/SvEv * C57BL/6J
ES Cell Line:
Mutant ES Cell Line:
Model Source:

M_MECP2_5.15_CKO_HT

Model Type: Genetic
Model Genotype: Heterozygous
Mutation: Conditional heterozygous deletion of exon 3- 4 of the Mecp2 gene using Advillin-cre, in dorsal root ganglion and trigeminal somatosensory neurons, while Mecp2 expression is preserved in the spinal cord (females)
Allele Type: Conditional loss-of-function
Strain of Origin:
Genetic Background: 129/SvEv * C57BL/6J
ES Cell Line:
Mutant ES Cell Line:
Model Source:

M_MECP2_46_KI_HE_TRUNC(N-TERM)

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Deletion of N terminal of Mecp2 (dN) knockin mice were produced by replacing the endogenous Mecp2 allele in embryonic stem cells, which were used to produce germline-transmitting chimaeras. Knockin mice were crossed onto a C57BL/6J background for four generations.
Allele Type: LOF Knockin
Strain of Origin:
Genetic Background: C57BL/6J
ES Cell Line: 129/Ola E14 TG2a
Mutant ES Cell Line:
Model Source:

M_MECP2_47_KI_HE_TRUNC(N-C-TERM)

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Deletion of N and C terminals of Mecp2 (dNC) knockin mice were produced by replacing the endogenous Mecp2 allele in embryonic stem cells, which were used to produce germline-transmitting chimaeras. Knockin mice were crossed onto a C57BL/6J background for four generations.
Allele Type: LOF Knockin
Strain of Origin:
Genetic Background: C57BL/6J
ES Cell Line: 129/Ola E14 TG2a
Mutant ES Cell Line:
Model Source:

M_MECP2_48_KI_HE_TRUNC(N-I-C)

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Deletion of N and C terminals and intermediate region of Mecp2 (dNIC) knockin mice were produced by replacing the endogenous Mecp2 allele in embryonic stem cells, which were used to produce germline-transmitting chimaeras. Knockin mice were crossed onto a C57BL/6J background for four generations.
Allele Type: LOF Knockin
Strain of Origin:
Genetic Background: C57BL/6J
ES Cell Line: 129/Ola E14 TG2a
Mutant ES Cell Line:
Model Source:

M_MECP2_49_KI_HE_R133C

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Knockin mutant with R133C mutation.
Allele Type: LOF Knockin
Strain of Origin:
Genetic Background:
ES Cell Line:
Mutant ES Cell Line:
Model Source:

M_MECP2_50_KI_HE_STOP

Model Type: Genetic
Model Genotype: Homozygous
Mutation: Mecp2 dNIC STOP knockin mice are functionally knockouts due to the insertion of a floxed transcriptional STOP cassette in intron 2 of the Mecp2 dNIC gene.
Allele Type: Knockout
Strain of Origin:
Genetic Background: C57BL/6J
ES Cell Line: 129/Ola E14 TG2a
Mutant ES Cell Line:
Model Source:

M_MECP2_6_KD

Model Type: Genetic
Model Genotype: Wildtype
Mutation: Seven-week-old wildtype C57BL/6 male mice were injected with MeCP2-siRNA (1385135, NM_010788.2), bilaterally in the dorsal striatum using a stereotaxic apparatus, resulting in a reduction of Mecp2 transcript levels to about 0.3 fold compared with control siRNA injected mice.
Allele Type: Knockdown
Strain of Origin: C57Bl/6
Genetic Background: C57Bl/6
ES Cell Line:
Mutant ES Cell Line:
Model Source: Daehan BioLink (Eumsung, Chungbuk, Republic of Korea)

M_MECP2_51_CKO_HT

Model Type: Genetic
Model Genotype: Heterozygous
Mutation: Heterozygous mutant female mice with sensory neuron specific deletion of Mecp2 were generated by crossing Mecp2 floxed mice with loxp sites flanking exons 3 to 4 with Advillin-Cre driver mice (Advillin-Cre; Mecp2f/+); M_MECP2_5.15_CKO_HT
Allele Type: Conditional knockout
Strain of Origin: Not specified
Genetic Background: C57BL/6J*129/SvEv*CD1
ES Cell Line:
Mutant ES Cell Line:
Model Source: Jackson Laboratory; RRID:IMSR_JAX:006847; Fan Wang; RRID:IMSR_JAX:032536

M_MECP2_52_CKO_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Hemizygous mutant male mice with sensory neuron specific deletion of Mecp2 were generated by crossing Mecp2 floxed mice with loxp sites flanking exons 3 to 4 with Advillin-Cre driver mice (Advillin-Cre; Mecp2f/y); M_MECP2_5.15_CKO_HE
Allele Type: Conditional knockout
Strain of Origin: Not specified
Genetic Background: C57BL/6J*129/SvEv*CD1
ES Cell Line:
Mutant ES Cell Line:
Model Source: Jackson Laboratory; RRID:IMSR_JAX:006847; Fan Wang; RRID:IMSR_JAX:032536

M_MECP2_53_KO_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Mecp2^STOP/y mice possess a loxP-flanked STOP cassette in intron 2 of the Mecp2 gene on the X chromosome resulting in the absence of wildtype protein; M_MECP2_40_KI_HE_STOP
Allele Type: Knockout
Strain of Origin: Not specified
Genetic Background: C57BL/6J*129/SvEv*CD1
ES Cell Line:
Mutant ES Cell Line:
Model Source: Jackson Laboratory; RRID:IMSR_JAX:006849

M_MECP2_54_CKO_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Hemizygous mutant male mice with sensory neuron specific inducible deletion of Mecp2 (Advillin-CreERT2; Mecp2^f/y) in the early postnatal period (P5) were generated by crossing Mecp2 floxed mice with loxp sites flanking exons 3 to 4 with transgenic Advillin-CreERT2 driver mice that expresse a tamoxifen-inducible iCre recombinase directed by endogenous Avil (advillin) promoter elements in the dorsal root ganglia and sensory neurons; M_MECP2_5.13_CKO_HE
Allele Type: Conditional knockout
Strain of Origin: Not specified
Genetic Background: C57BL/6J*129/SvEv*CD1
ES Cell Line:
Mutant ES Cell Line:
Model Source: Jackson Laboratory; John Wood; RRID:IMSR_JAX:032027 (Lau et al, 2011); RRID:IMSR_JAX:006847

M_MECP2_55_CKO_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Hemizygous mutant male mice with sensory neuron specific inducible deletion of Mecp2 (Advillin-CreERT2; Mecp2^f/y) in the early postnatal period (P10) were generated by crossing Mecp2 floxed mice with loxp sites flanking exons 3 to 4 with transgenic Advillin-CreERT2 driver mice that expresse a tamoxifen-inducible iCre recombinase directed by endogenous Avil (advillin) promoter elements in the dorsal root ganglia and sensory neurons; M_MECP2_5.13_CKO_HE
Allele Type: Conditional knockout
Strain of Origin: Not specified
Genetic Background: C57BL/6J*129/SvEv*CD1
ES Cell Line:
Mutant ES Cell Line:
Model Source: Jackson Laboratory; John Wood; RRID:IMSR_JAX:032027 (Lau et al, 2011); RRID:IMSR_JAX:006847

M_MECP2_56_CKO_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Hemizygous mutant male mice with sensory neuron specific inducible deletion of Mecp2 (Advillin-CreERT2; Mecp2^f/y) in the early postnatal period (P28) were generated by crossing Mecp2 floxed mice with loxp sites flanking exons 3 to 4 with transgenic Advillin-CreERT2 driver mice that expresse a tamoxifen-inducible iCre recombinase directed by endogenous Avil (advillin) promoter elements in the dorsal root ganglia and sensory neurons; M_MECP2_5.13_CKO_HE
Allele Type: Conditional knockout
Strain of Origin: Not specified
Genetic Background: C57BL/6J*129/SvEv*CD1
ES Cell Line:
Mutant ES Cell Line:
Model Source: Jackson Laboratory; John Wood; RRID:IMSR_JAX:032027 (Lau et al, 2011); RRID:IMSR_JAX:006847

M_MECP2_57_KI_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Male knockin mice harboring an arginine-to-cysteine missense R306 mutation in Mecp2 (Mecp2^R306C), a common allele in Rett syndrome patients. These mutants were used because Mecp2^R306C mutant mice live longer than Mecp2 null allele, allowing a full two-week behavioral assessment at six to eight weeks of age prior to the development of severe breathing abnormalities. As controls for the Gabrb3 rescue experiments these mice were injected with AAV.FLEx.GABRB3.mCHERRY at P5 but the lack of Cre prevented Gabrb3 expression; M_MECP2_39_KI_HE_R306C
Allele Type: ASD LOF knockin
Strain of Origin: Not specified
Genetic Background: C57BL/6J
ES Cell Line:
Mutant ES Cell Line: 129/Ola E14 TG2a mouse ES cells
Model Source: Michael Greenberg; Lyst et al., 2013; PMID 23770565

M_MECP2_58_KI_HT

Model Type: Genetic
Model Genotype: Heterozygous
Mutation: Female mice heterozygous for the Mecp2 mutation R306C. Controls were female Mecp2^R/R littermates. As controls for the Gabrb3 rescue experiments these mice were injected with AAV.FLEx.GABRB3.mCHERRY at P5 but the lack of Cre prevented Gabrb3 expression; M_MECP2_39_KI_HE_R306C
Allele Type: ASD LOF knockin
Strain of Origin: Not specified
Genetic Background: C57BL/6J
ES Cell Line:
Mutant ES Cell Line: 129/Ola E14 TG2a mouse ES cells
Model Source: Michael Greenberg; Lyst et al., 2013; PMID 23770565

M_MECP2_10_PME_HIPPOCAMPUS

Model Type: Genetic
Model Genotype: Wildtype
Mutation: Mice with locus-specific methylation at the transcription start site of Mecp2 in the hippocampus were generated by injecting AAV-based methylation vectors (AAV-DNMT3A-N-dCas9, AAV-AAV-C-dCas9, AAV-5U6-sgRNAs-EGFP) bilaterally into the hippocampus of adult mice. Behavioral tests were performed 4 weeks after injection.
Allele Type: Loss of function
Strain of Origin: C57BL/6
Genetic Background: C57BL/6
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: PMID 32015323

M_MECP2_9_PME

Model Type: Genetic
Model Genotype: Wildtype
Mutation: Mice with locus-specific methylation at the transcription start site of Mecp2 were generated using nuclease-deactivated Cas9 (dCas9) fused with DNA methyltransferase catalytic domains. DNMT3L-DNMT3A-dCas9 or DNMT3LDNMT3A-mut- dCas9 plasmids were injected into zygotes from superovulated female C57BL/6 mice. (PME, promoter methylation).
Allele Type: Loss of function
Strain of Origin: C57BL/6
Genetic Background: C57BL/6
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: PMID 32015323

M_MECP2_59_TG_2X

Model Type: Genetic GOF
Model Genotype: Transgenic
Mutation: A full-length copy of the human gene was injected into fvb fertilized oocytes and 2-fold higher levels of protein compared to endogenous mecp2 was established. fvb-background mecp2-duplication (tg1) mice (collins et al., 2004), were crossed to c57 thy1-gfp-m homozygotes (jackson laboratory) to generate f1c57;fvb mecp2-duplication;thy1-gfpm mice and thy1-gfp-m littermate controls. [note: construct is adapted from existing m_mecp2_34_tg_2x but has a mixed background and reporter]. for motor cortex assessment animals were trained for four consecutive trials daily for four days in a row.
Allele Type: Transgenic
Strain of Origin: FVB
Genetic Background: F1C57*FVB
ES Cell Line: FVB
Mutant ES Cell Line: FVB
Model Source: 15351775, Collins et al, 2004

M_MECP2_5.12_CKO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Spontaneous movement1
Decreased
Description: Decreased spontaneous movement
Exp Paradigm: Open field test
 Open field test
 3-8 weeks
Limb posture1
Abnormal
Description: Abnormal limb postures; hindlimb clasping
Exp Paradigm: Tail suspension test
 Tail suspension test
 Unreported
Gait1
Abnormal
Description: Abnormal stiff, uncoordinated gait
Exp Paradigm: General observations
 General observations
 3-8 weeks
Size/growth1
Decreased
Description: Decreased average body weight
Exp Paradigm: General observations
 General observations
 4 weeks
Mortality/lethality1
Increased
Description: Increased lethality
Exp Paradigm: General observations
 General observations
 7.5 weeks
Developmental trajectory1
Abnormal
Description: Abnormal developmental trajectory: irregular breathing, uneven wearing of the teeth, misaligned jaws, and internalized testes of males
Exp Paradigm: General observations
 General observations
 Unreported
Grip strength1
 No change
 Grip strength test
 Unreported
Vision1
 No change
 Forepaw reaching test
 Unreported
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Social behavior

M_MECP2_5_KO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity: ambulatory activity7
Decreased
Description: Mecp2 hemizygous mice show a decrease in distance traveled in the open field test.
 Open field test
 6-8 weeks
Gait1
Abnormal
Description: Abnormal stiff, uncoordinated gait
Exp Paradigm: General observations
 General observations
 3-8 weeks
Spontaneous movement1
Decreased
Description: Decreased spontaneous movement
Exp Paradigm: Open field test
 Open field test
 3-8 weeks
General locomotor activity6
Abnormal
Description: Mecp2-null mutant mice showed an increase in phenotypic severity scores compared to wt controls.
Exp Paradigm: NA
 General observations
 4-28 weeks
Limb posture6
Abnormal
Description: Mecp2-null mutant mice showed an increase in phenotypic severity scores compared to wt controls.
Exp Paradigm: NA
 General observations
 4-28 weeks
General locomotor activity5
Decreased
Description: Mecp2 kos have reduced distance traveled in the open field test
Exp Paradigm: NA
 Open field test
 6-8 weeks
Limb posture1
Abnormal
Description: Abnormal limb postures; hindlimb clasping
Exp Paradigm: NA
 General observations
 Unreported
Gait6
Abnormal
Description: Mecp2-null mutant mice showed an increase in phenotypic severity scores compared to wt controls.
Exp Paradigm: NA
 General observations
 4-28 weeks
Tremor6
Abnormal
Description: Mecp2-null mutant mice showed an increase in phenotypic severity scores compared to wt controls.
Exp Paradigm: NA
 General observations
 4-28 weeks
Synaptic neuroreceptors5
Decreased
Description: Mecp2 kos have reduced expression of gabrb3 in puncta that also express vglut1 in the spinal cord dorsal horn lamina iii
Exp Paradigm: NA
 Immunohistochemistry
 3-6 months
Brain morphology3
Decreased
Description: Decreased cortical thickness in motor-frontal cortex
Exp Paradigm: Bright-field video micrograph analysis of slices of s1 cortex
 Photomicrographic analysis
 3-4 weeks
Brain cytoarchitecture2
Decreased
Description: Decreased number of th positive neurons in the locus coerulues (lc)
Exp Paradigm: Immunostaining analysis of the lc using both antibodies for th and mecp1
 Immunohistochemistry
 7 weeks
Synaptic transmission: excitatory3
Decreased
Description: There is decreased local excitatory input to l2/3 pyramidal neurons
Exp Paradigm: Loose-seal recordings from synapse l2/3 of pyramidal neurons
 Laser scanning photostimulation
 Unreported
Synaptic transmission: excitatory3
Decreased
Description: Decreased intensity of excitation profile of l3/5a pyramidal neurons
Exp Paradigm: Loose-seal recordings from synapse l3/5a of pyramidal neurons
 Laser scanning photostimulation
 Unreported
Synaptic transmission: excitatory3
Decreased
Description: Decreased ascending excitatory input at the l3/5a pyramidal neuron zone
Exp Paradigm: Patch clamp recording of the l3/5a pyramidal neuron the area around which is photostimulated by focal glutamate uncaging
 Whole-cell patch clamp
 3-4 weeks
Startle response: acoustic stimulus5
Decreased
Description: Mecp2 kos have reduced startle reflex to 125 db noise
Exp Paradigm: NA
 Startle response test
 6-8 weeks
Sensorimotor gating5
Decreased
Description: Mecp2 kos have enhanced response even in acoustic prepulse inhibition compared to controls and unlike shank3 het and fmr1 hemizygous mice tested by orefice et al
Exp Paradigm: NA
 Prepulse inhibition
 6-8 weeks
Touch5
Increased
Description: Mecp2 kos show an increased response to just air puff indicating aberrant sensitivity or hypersensitivity
Exp Paradigm: NA
 Response to air puff
 6-8 weeks
Sensory-evoked response: excitation: auditory stimulus4
Increased
Description: Mecp2 ko mice show significantly increased area of activation in the insular cortex, in response to auditory cues, similar to btbr mice
Exp Paradigm: NA
 Measurement of area of activation (roi) in the insular cortex
 Adult
Multisensory integration: sensory neurons of insular cortex: auditory-tactile4
Decreased
Description: Mecp2 ko mice show significantly reduced multisensory integration in the insular cortex
Exp Paradigm: Degree of integration was determined by dividing the response amplitude upon combined stimulation by the sum of unisensory responses
 Quantification of degree of integration
 Adult
Tactile memory5
Decreased
Description: Mecp2 kos have reduced glabrous skin tactile discrimination and memory for objects differing in texture (rough or smooth) and do not preferentially interact with a novel textured-object over a familiar one
Exp Paradigm: NA
 Textured novel object recognition test (t-nort)
 6-8 weeks
Sensorimotor gating: tactile cue5
Decreased
Description: Tactile prepulse inhibition responses are enhanced in mecp2 ko mice, as opposed to control littermates that display reduced magnitude of acoustic startle response when they receive an air puff prepulse
Exp Paradigm: NA
 Prepulse inhibition
 6-8 weeks
Hypersensitivity: tactile stimulus7
Increased
Description: Mecp2 hemizygous pups show greater displacement magnitude, measured by optical flow point, in response to air puff stimuli.
Exp Paradigm: optical flow point tracking to measure reactivity to single presentations of 0.10-, 0.25-, 0.50- and 0.75-psi air puff stimuli
 Response to air puff
 P4
Startle response: tactile stimulus7
Increased
Description: Mecp2 hemizygous mice exhibit enhanced startle response to a gentle air puff stimulus alone.
 Response to air puff
 6-8 weeks
Sensorimotor gating: tactile cue7
Decreased
Description: Mecp2 hemizygous mice exhibit enhanced sensitivity to back hairy skin stimulation, as measured by tactile prepulse inhibition (PPI) of an acoustic startle response.
Exp Paradigm: 0.9-psi air puff preceded 120 dB acoustic startle pulse,delivered at variable interstimulus intervals
 Prepulse inhibition
 6-8 weeks
Social dominance5
Decreased
Description: Mecp2 kos exhibit decreased dominance and aggression and lose majority of matches against control mice
Exp Paradigm: NA
 Tube test of social dominance
 6-8 weeks
Social approach5
Decreased
Description: Mecp2 kos have reduced preference for stimulus stranger mouse over object
Exp Paradigm: NA
 Three-chamber social approach test
 6-8 weeks
Social approach7
Decreased
Description: Mecp2 hemizygous mice show no preference for novel mouse over novel object in the social approach test.
 Three-chamber social approach test
 6-8 weeks
Social memory5
Decreased
Description: Mecp2 kos have no preference for novel stranger mouse over familiar mouse
Exp Paradigm: NA
 Three-chamber social approach test
 6-8 weeks
Nest building behavior5
Decreased
Description: Mecp2 kos reduced nest building score measured by weighing unshredded material
Exp Paradigm: NA
 Nest building assay
 6-8 weeks
Respiratory function5
Decreased
Description: Mecp2 kos have reduced tidal volume, respiration rate and expiration volume compared to control mice
Exp Paradigm: NA
 Whole body plethysmography
 2-2.5 months
Mortality/lethality6
Increased
Description: Mecpt-null mutant mice showed an increase in mortality compared to wt controls.
Exp Paradigm: NA
 General observations
 0-30 weeks
Mortality/lethality5
Increased
Description: Mecp2 ko mice have reduced lifespan
Exp Paradigm: NA
 Survival analysis
 1-10 months
Size/growth5
Decreased
Description: Mecp2 kos have reduced body weight compared to littermate controls
Exp Paradigm: NA
 Body weight measurement
 2-2.5 months
Developmental trajectory1
Abnormal
Description: Abnormal developmental trajectory: irregular breathing, uneven wearing of the teeth, misaligned jaws, and internalized testes of males
Exp Paradigm: General observations
 General observations
 Unreported
Size/growth1
Decreased
Description: Decreased average body weight
Exp Paradigm: General observations
 General observations
 4 weeks
Anxiety5
Increased
Description: Mecp2 kos have reduced time spent in the center of of and reduced preference for the open arms in the elevated plus maze test indicating increased anxiety
Exp Paradigm: Elevated plus maze test
 Elevated plus maze test
 6-8 weeks
Habituation to aversive stimuli7
Decreased
Description: Mecp2 hemizygous pups show greater displacement magnitude, measured by optical flow point, in response to repeated air puff stimuli. A smaller number of pups show habituation to repeated stimuli.
Exp Paradigm: optical flow point tracking to measure reactivity to ten presentations of a 1.0-psi stimulus at 20- to 30-s intervals
 Response to air puff
 P4
Anxiety7
Increased
Description: Mecp2 hemizygous mice show decreased time in the center of the open field arena.
 Open field test
 6-8 weeks
Exploratory activity5
Decreased
Description: Mecp2 kos conduct normal exploration of objects in textured nort
Exp Paradigm: NA
 Textured novel object recognition test (t-nort)
 6-8 weeks
Anxiety5
Increased
Description: Mecp2 kos have reduced time spent in the center of of and reduced preference for the open arms in the elevated plus maze test indicating increased anxiety
Exp Paradigm: Open field test
 Open field test
 6-8 weeks
Habituation to aversive stimuli5
Decreased
Description: Mecp2 kos have reduced habituation (eventual decrease in startle amplitude in response to series of trials) to acoustic startle
Exp Paradigm: NA
 Startle response test
 6-8 weeks
Object recognition memory: long-term recall5
Decreased
Description: Mecp2 ko mice have reduced preference for novel object when the retention period (or interval) is extended to 1 hr from 5 min, whereas wt mice still prefer the novel object
Exp Paradigm: NA
 Novel object recognition test
 6-8 weeks
Object recognition memory5
Decreased
Description: Mecp2 ko mice have reduced object recognition memory and novelty-seeking behavior even when objects differ in shape or color
Exp Paradigm: NA
 Novel object recognition test
 6-8 weeks
Gene expression2
Decreased
Description: Decreased tyrosine hydroxylase (th) mrna expression in pons
Exp Paradigm: Th mrna expression
 Quantitative pcr (qrt-pcr)
 P15, p30, p50
Targeted expression7
Decreased
Description: Mecp2 hemizygous pups do not show expression of Mecp2 protein in dorsal root ganglia neurons, whereas wildtype mice do.
Exp Paradigm: NeuN, Mecp2
 Immunohistochemistry
 P4
Protein expression level evidence2
Decreased
Description: Decreased levels of tyrosine hdyroxylase (th) protein expression in the locus coeruleus
Exp Paradigm: Th/mecp2 protein expression
 Immunohistochemistry
 7 weeks
Exploratory activity5
 No change
 Textured novel object recognition test (t-nort)
 6-8 weeks
Grip strength1
 No change
 Grip strength test
 Unreported
Neural spike train signal frequency3
 No change
 Whole-cell patch clamp
 3-4 weeks
Synaptic transmission3
 No change
 Whole-cell patch clamp
 3-4 weeks
Synaptic transmission: inhibitory3
 No change
 Whole-cell patch clamp
 3-4 weeks
Apoptosis2
 No change
 Tunel assay
 4, 7.5 weeks
Vision1
 No change
 Forepaw reaching test
 Unreported
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Motor phenotype, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_5_KO_HT

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Grip strength5
Decreased
Description: Increase in foot slips
 Wire hang test
 24 weeks
Motor coordination and balance5
Decreased
Description: Decreased latency to fall off the rotarod, increased foot slips
 Accelerating rotarod test
 8-32 weeks
General locomotor activity: Ambulatory activity5
Decreased
Description: Decreased total distance travelled
 Open field test
 25 weeks
Limb posture1
Abnormal
Description: Abnormal limb postures; hindlimb clasping
Exp Paradigm: Tail suspension test
 Tail suspension test
 > 3 months
General locomotor activity1
Decreased
Description: Decreased locomotor activity demonstrated by less squares visited and increased time spent being immobile
Exp Paradigm: Open field test
 Open field test
 Unreported
Hypoactivity3
Increased
Description: Increased hypoactivity measured as early onset of hypoactivity
Exp Paradigm: General observations in separate cage
 General observations
 0-10 months
Clasping reflex3
Increased
Description: Increased hindlimb clasping as observed at as early as 16 weeks old mice (100% hindlimb clasping by 35 weeks old)
Exp Paradigm: General observations in separate cage
 General observations
 0-7 weeks
Tremor3
Increased
Description: Increased tremor indicated by earlier onset (20 weeks old in avarage)
Exp Paradigm: General observations in separate cage
 General observations
 0-10 months
Neuronal morphology5
Decreased
Description: Decreased soma and nuclear area
 Immunofluorescence staining
 24 weeks
Dendritic architecture: spine density5
Decreased
Description: Decreased spine density
 Immunofluorescence staining
 24 weeks
Dendritic architecture: dendritic tree complexity5
Decreased
Description: Decreased dendritic complexity
 Immunofluorescence staining
 24 weeks
Spontaneous post synaptic event amplitude: inhibitory currents5
Decreased
Description: Presymptomatic training improved the frequencies of sipscs and sepscs of mecp2 negative neurons in rett mice (fig. 4f, h), but not the amplitudes (fig. 4g, i).
 Whole-cell patch clamp
 13 weeks
Event related potential (erp) in electroencephalography (eeg)4
Abnormal
Description: Abnormal middle and late components indicated by larger n1 component, no change in p2 amplitude but delayed latency
Exp Paradigm: Eeg recordings after delivery of auditory stimuli
 Electroencephalogram (eeg)
 4-5 months
Spontaneous post synaptic event amplitude: excitatory currents5
Decreased
Description: Presymptomatic training improved the frequencies of sipscs and sepscs of mecp2 negative neurons in rett mice (fig. 4f, h), but not the amplitudes (fig. 4g, i).
 Whole-cell patch clamp
 13 weeks
Event related potential (erp) in electroencephalography (eeg)4
Abnormal
Description: Abnormal auditory erp frequency analysis indicated by increased phase locking in gamma range
Exp Paradigm: Spectral decomposition of auditory-evoked response waveforms
 Event related potential (erp)
 4-5 months
Spontaneous post synaptic event frequency: inhibitory currents5
Decreased
Description: Presymptomatic training improved the frequencies of sipscs and sepscs of mecp2 negative neurons in rett mice (fig. 4f, h), but not the amplitudes (fig. 4g, i).
 Whole-cell patch clamp
 13 weeks
Neuronal activation following behavioral stimulation5
Decreased
Description: Decreased fos positive neurons
Exp Paradigm: used cFos-targeted recombination in active populations (Fos-TRAP) to label task-specific neurons activated during water-maze
 Immunofluorescence staining
 24 weeks
Event related potential (erp) in electroencephalography (eeg)4
Abnormal
Description: Abnormal auditory erp frequency analysis indicated by increase in induced gamma power around 45 hz, increase in beta-band activity, no change in theta and delta-band component
Exp Paradigm: Spectral decomposition of auditory-evoked response waveforms
 Event related potential (erp)
 4-5 months
Spontaneous post synaptic event frequency: excitatory currents5
Decreased
Description: Presymptomatic training improved the frequencies of sipscs and sepscs of mecp2 negative neurons in rett mice (fig. 4f, h), but not the amplitudes (fig. 4g, i).
 Whole-cell patch clamp
 13 weeks
Event related potential (erp) in electroencephalography (eeg)4
Abnormal
Description: Abnormal visual erp indicated by increased n1 component in response to visual stimuli; no change in p2 wave latency
Exp Paradigm: Eeg recordings after delivery of visual stimuli
 Electroencephalogram (eeg)
 4-5 months
Startle response: acoustic stimulus5
Decreased
Description: Decreased startle amplitude
 Acoustic startle reflex test
 24 weeks
Hormone levels4
Decreased
Description: Abnormal bdnf protein quantification demonstrated by no change in concentration in cortex; decreased levels in striatum
Exp Paradigm: Quantification using elisa at site of translation and target site
 Elisa
 7.5 weeks
Developmental trajectory1
Abnormal
Description: Abnormal developmental trajectory: irregular breathing
Exp Paradigm: General observations
 General observations
 9 months
Anxiety5
Decreased
Description: More time spent in open arms
 Elevated plus maze test
 24 weeks
Cued or contextual fear conditioning: Memory of context5
Decreased
Description: Decreased time spent freezing
 Fear conditioning test
 24 weeks
Spatial working memory5
Decreased
Description: Increased latency for memory acquisition
 Morris water maze test
 24 weeks
Spatial reference memory5
Decreased
Description: Decreased time in target quadrant in probe trial
 Morris water maze test
 24 weeks
Gene expression3
Increased
Description: Increased expression of genes fkbp5 and sgk1 in brain
Exp Paradigm: Fkbp5 and sgk1 gene expression
 Quantitative pcr (qrt-pcr)
 5 weeks
Protein expression level evidence4
Decreased
Description: Decreased levels of hap1a and hap1b isoforms in midbrain ventral area, reduced hap1a isoform in cortex, no hap1b isoform in cortex
Exp Paradigm: Hap1 protein levels
 Western blot
 8 weeks
Gene expression2
Decreased
Description: Decreased tyrosine hydroxylase (th) mrna expression in pons
Exp Paradigm: Th mrna expression
 Quantitative pcr (qrt-pcr)
 10-12 months
Protein expression level evidence4
Decreased
Description: Decreased htt protein levels in hypothalamus, and hippocampus
Exp Paradigm: Htt protein levels
 Immunohistochemistry
 8 weeks
Protein expression level evidence4
Decreased
Description: Decreased hap1 protein levels in hypothalamus, nucleus tractus solitarius, midbrain ventral area, locus coeruleus, and pons
Exp Paradigm: Hap1 protein levels
 Immunohistochemistry
 8 weeks
Mortality/lethality3
 No change
 General observations
 5.5 months
Size/growth5
 No change
 Body weight measurement
 Adult
Anxiety1
 No change
 Open field test
 Unreported
Cued or contextual fear conditioning: Memory of cue5
 No change
 Fear conditioning test
 24 weeks
Gene expression4
 No change
 Western blot
 Unreported
Gene expression4
 No change
 Quantitative pcr (qrt-pcr)
 Unreported
Protein expression level evidence2
 No change
 Immunohistochemistry
 Unreported
Swimming ability5
 No change
 Morris water maze test
 Adult
Event related potential (erp) in electroencephalography (eeg)4
 No change
 Electroencephalogram (eeg)
 4-5 months
Startle response: acoustic stimulus5
 No change
 Prepulse inhibition
 24 weeks
Social approach5
 No change
 Three-chamber social approach test
 24 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Motor phenotype, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_1.4_CKO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Brain size1
Decreased
Description: Reduced brain size and weight
Exp Paradigm: Autopsy analysis
 Pathology
 Unreported
Brain anatomy1
Abnormal
Description: Reduced neuronal size; increased density
Exp Paradigm: Histological analysis of sections utilizing thionine (neuronal) and dapi (nuclear) stain
 Histology
 Unreported
Brain anatomy1
Decreased
Description: Cell bodies and nuclei of hippocampus, cerebral cortex,but not cerebellum were of smaller size and more densely packed
Exp Paradigm: Histological analysis of sections utilizing thionine (neuronal) and dapi (nuclear) stain
 Histology
 Unreported
Brain size1
Decreased
Description: Reduced brain size and weight.
Exp Paradigm: Autopsy analysis
 Pathology
 Unreported
Size/growth1
Increased
Description: Increased size/growth; overweight/physical deterioration
Exp Paradigm: General observations
 General observations
 3-6 months
Developmental trajectory1
Abnormal
Description: Emergence of abnormal behavior such as nervousness, body trembling, pila erection, hard respiration around 3 months
Exp Paradigm: General observations
 General observations
 >3 months
Developmental trajectory1
Abnormal
Description: Abnormal developmental trajectory; nervousness, body trembling, pila erection, hard respiration
Exp Paradigm: General observations
 General observations
 >3 months
Size/growth1
Increased
Description: Overweight/physical deterioration
Exp Paradigm: General observations
 General observations
 3-6 months
General characteristics1
 No change
 General observations
 0-3 months
General characteristics1
 No change
 General observations
 0-3 months
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Motor phenotype, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_1_CKO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Brain size1
Decreased
Description: Reduced brain size and weight
Exp Paradigm: Autopsy analysis
 Measurement of tissue weight
 Unreported
Brain anatomy1
Decreased
Description: Cell bodies and nuclei of hippocampus, cerebral cortex, and cerebellum were of smaller size and more densely packed
Exp Paradigm: Histological analysis of sections utilizing thionine (neuronal) and dapi (nuclear) stain
 Histology
 Unreported
Brain cytoarchitecture1
Decreased
Description: Reduced neuronal cell size in ca2 region
Exp Paradigm: Tracing cell contours on brain section
 Histology
 Unreported
Brain cytoarchitecture1
Decreased
Description: 15-25% smaller neurons in ca2 region
Exp Paradigm: Tracing cell contours on brain section
 Histology
 Unreported
Brain size1
Decreased
Description: Reduced brain size and weight.
Exp Paradigm: Autopsy analysis
 Measurement of tissue weight
 Unreported
Brain anatomy1
Decreased
Description: Reduced neuronal size; increased density
Exp Paradigm: Histological analysis of sections utilizing thionine (neuronal) and dapi (nuclear) stain
 Histology
 Unreported
Size/growth1
Increased
Description: Increased size/growth
Exp Paradigm: General observations
 General observations
 8 weeks
Developmental trajectory1
Abnormal
Description: Emergence of abnormal behavior such as nervousness, body trembling, pila erection, hard respiration around 5 weeks
Exp Paradigm: General observations
 General observations
 5 weeks
Developmental trajectory1
Abnormal
Description: Abnormal developmental trajectory; nervousness, body trembling, pila erection, hard respiration
Exp Paradigm: General observations
 General observations
 5 weeks
Size/growth1
Increased
Description: Overweight/physical deterioration
Exp Paradigm: General observations
 General observations
 8 weeks
Protein expression level evidence1
Decreased
Description: No detection of mecp2 protein but peptides of smaller sizes
Exp Paradigm: Protein expression
 Western blot
 Unreported
Gene expression1
Decreased
Description: Slightly smaller mecp2 transcript at a reduced level
Exp Paradigm: Rna expression
 Northern blot
 Unreported
Protein expression level evidence1
Decreased
Description: Reduced mecp2 protein expression
Exp Paradigm: Protein expression
 Immunohistochemistry
 Unreported
Gene expression1
Decreased
Description: Reduced mecp2 rna transcript expression
Exp Paradigm: Rna expression
 Northern blot
 Unreported
Protein expression level evidence1
Decreased
Description: No mecp2 immunoreactivity in brain.
Exp Paradigm: Protein expression
 Immunohistochemistry
 Unreported
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Motor phenotype, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_1_KO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Brain size1
Decreased
Description: Reduced brain size and weight
Exp Paradigm: Autopsy analysis
 Pathology
 Unreported
Brain anatomy1
Decreased
Description: Cell bodies and nuclei of hippocampus, cerebral cortex, and cerebellum were of smaller size and more densely packed
Exp Paradigm: Histological analysis of sections utilizing thionine (neuronal) and dapi (nuclear) stain
 Histology
 Unreported
Brain cytoarchitecture1
Decreased
Description: Reduced neuronal cell size
Exp Paradigm: Tracing cell contours on brain section
 Cell contour analysis
 Unreported
Brain cytoarchitecture1
Decreased
Description: 15-25% smaller neurons in ca2 region
Exp Paradigm: Tracing cell contours on brain section
 Cell contour analysis
 Unreported
Brain size1
Decreased
Description: Reduced brain size and weight.
Exp Paradigm: Autopsy analysis
 Measurement of tissue weight
 Unreported
Brain anatomy1
Decreased
Description: Reduced neuronal size; increased density
Exp Paradigm: Histological analysis of sections utilizing thionine (neuronal) and dapi (nuclear) stain
 Histology
 Unreported
Size/growth1
Increased
Description: Increased size/growth
Exp Paradigm: General observations
 General observations
 8 weeks
Developmental trajectory1
Abnormal
Description: Emergence of abnormal behavior such as nervousness, body trembling, pila erection, hard respiration around 5 weeks
Exp Paradigm: General observations
 General observations
 5 weeks
Developmental trajectory1
Abnormal
Description: Abnormal developmental trajectory
Exp Paradigm: General observations
 General observations
 5 weeks
Size/growth1
Increased
Description: Overweight/physical deterioration
Exp Paradigm: General observations
 General observations
 8 weeks
Protein expression level evidence1
Decreased
Description: No detection of mecp2 protein but peptides of smaller sizes
Exp Paradigm: Protein expression
 Western blot
 Unreported
Gene expression1
Decreased
Description: Slightly smaller mecp2 transcript at a reduced level
Exp Paradigm: Rna expression
 Northern blot
 Unreported
Protein expression level evidence1
Decreased
Description: Reduced mecp2 protein expression
Exp Paradigm: Protein expression
 Immunohistochemistry
 Unreported
Gene expression1
Decreased
Description: Reduced mecp2 rna transcript expression
Exp Paradigm: Rna expression
 Northern blot
 Unreported
Protein expression level evidence1
Decreased
Description: No mecp2 immunoreactivity in brain.
Exp Paradigm: Protein expression
 Immunohistochemistry
 Unreported
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Motor phenotype, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_34_TG_2X

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Motor coordination and balance1
Abnormal
Description: Mecp2 tg (2x) mice failed to move in the dowel test and remained immobile for long periods of time
Exp Paradigm: NA
 Dowel walk test
 6 weeks
Motor coordination and balance1
Increased
Description: At 10 weeks and 20 weeks of age mecp2 tg (2x) mice has increased latency to fall off the accelerating rotarod compared to wildtype over 4 days of testing with 4 trials on each day, authors note that this may indicate enhanced cerebellar learning
Exp Paradigm: NA
 Accelerating rotarod test
 10 weeks, 20 weeks
Clasping reflex1
Increased
Description: Forepaw clasping in increased in mecp2 tg mice, first observed at 12-15 weeks
Exp Paradigm: NA
 Tail suspension test
 12-15 weeks
Synaptic plasticity: hippocampal ltp1
Increased
Description: Ltp is also enhanced relative to controls in the hippocampal schaffer collateral -ca1 synapses in mecp2 tg(2x) mice
Exp Paradigm: NA
 High-frequency stimulation (hfs)
 NA
Presynaptic function: paired-pulse facilitation1
Increased
Description: Ppf is greatly enhanced in hippocampal schaffer-collateral synapses in mecp2 tg mice
Exp Paradigm: NA
 Whole-cell patch clamp
 NA
Electroencephalogram (eeg) signature1
Abnormal
Description: Recordings made in the absence of an observable clonic seizures in 20 week old mecp2 tg mice showes abnormal spikes
Exp Paradigm: NA
 Electroencephalogram (eeg)
 20 weeks
Seizures1
Increased
Description: Increased clonic seizures are observed at 20 and 50 weeks of age for mecp2 tg (2x) mice , the seizures begin to manifest at 12-15 weeks
Exp Paradigm: NA
 General observations
 12-15 weeks, 20 weeks, 50 weeks
Electroencephalogram (eeg): signature of seizure/epilepsy1
Abnormal
Description: Recordings made during akinetic seizures (behavioral immobility) were also abnormal in 50 week olf mecp2 tg mice
Exp Paradigm: NA
 Electroencephalogram (eeg)
 50 weeks
Vision1
Decreased
Description: The original human mecp2-overexpressing mice, mecp2-tg mice on a fvb/n pure background, develop premature retinal degeneration, which can confound the interpretation of some behavioural tests
Exp Paradigm: Ophthalmological evaluation;
 Ophthalmological evaluation
 Adult
Reproductive function1
Decreased
Description: Mecp2 tg mice show decreased fertility
Exp Paradigm: NA
 General observations
 12-15 weeks
Skeletal development1
Decreased
Description: Increased observation of kyphosis ( outward curvature of spine) starting at age 12-15 weeks
Exp Paradigm: NA
 General observations
 12-15 weeks
Mortality/lethality1
Increased
Description: Premature death is observed, starting with reduced survival at ~ 20 weeks of age in mecp2 tg(2x) mice
Exp Paradigm: NA
 General observations
 18 weeks
Cued or contextual fear conditioning: memory of context1
Increased
Description: Mecp2 tg mice show increased freezing in response to context compared to wildtype controls, authors indicate enhanced hippocampal learning
Exp Paradigm: NA
 Fear conditioning test
 20 weeks
Targeted expression1
Increased
Description: Mecp2 transgene shows increased expression equal to about 2 fold of the protein levels from wild type, this includes the human transgene and the endogenous protein
Exp Paradigm: NA
 Western blot
 NA
Anxiety1
 No change
 Open field test
 Adult
Anxiety1
 No change
 Light-dark exploration test
 Adult
Cued or contextual fear conditioning: memory of cue1
 No change
 Fear conditioning test
 20 weeks
General locomotor activity1
 No change
 Open field test
 6-20 weeks
Motor coordination and balance1
 No change
 Accelerating rotarod test
 6 weeks
Synaptic transmission1
 No change
 Fepsp slope vs fiber volley amplitude
 NA
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Physiological parameters, Repetitive behavior, Social behavior

M_MECP2_36_TG_7X

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Clasping reflex1
Increased
Description: Increased clasping reflex is observed in mecp2 tg (7x) mice
Exp Paradigm: NA
 Tail suspension test
 3 weeks
Seizures1
Increased
Description: Increased clonic seizures are observed by 3 weeks of age in mecp3 tg (7x) mice
Exp Paradigm: NA
 General observations
 NA
Reproductive function1
Decreased
Description: Fertility is low in mecp2 tg (7x) mice
Exp Paradigm: NA
 General observations
 3 weeks
Skeletal development1
Decreased
Description: Increased observation of kyphosis ( outward curvature of spine) starting at 2-3 weeks of age
Exp Paradigm: NA
 General observations
 NA
Size/growth1
Decreased
Description: Mecp2 tg (7x) mice have smaller body size compared to controls observed by 2-3 weeks of age
Exp Paradigm: NA
 General observations
 3 weeks
Mortality/lethality1
Increased
Description: Majority of mecp2 tg(7x) mice die by 3 weeks of age
Exp Paradigm: NA
 General observations
 3 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Sensory, Social behavior

M_MECP2_5.2_KO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity2
Decreased
Description: Decreased locomotor activity
Exp Paradigm: Open field test
 Open field test
 9 weeks
General locomotor activity3
Decreased
Description: Decreased general locomotor activity as shown by progressive impairement in total distance moved and velocity
Exp Paradigm: Open field test
 Open field test
 Unreported
Motor coordination and balance4
Decreased
Description: Decreased motor coordination indicated by decreased latency to fall in rotarod test performance
Exp Paradigm: Rotarod test
 Accelerating rotarod test
 6-8 weeks
General locomotor activity4
Decreased
Description: Decreased general locomotor activity as indicated by decreased travelled distance
Exp Paradigm: Open field test
 Open field test
 6-8 weeks
Motor coordination and balance2
Decreased
Description: Decreased motor coordination and motor learning
Exp Paradigm: Rotarod test
 Accelerating rotarod test
 Unreported
Clasping reflex4
Increased
Description: Increased hindlimb clasping as observed at as early as 4 weeks old mice (100% hindlimb clasping by 8 weeks old)
Exp Paradigm: General observations in separate cage
 General observations
 0-14 weeks
Dendritic architecture: spine density1
Decreased
Description: Decreased diameter of apical dendrites in pyramidal neurons; decreased number of dendritic spines; decreased arborization
Exp Paradigm: Golgi-impregnated cortical sections
 Golgi-cox staining
 2-6 weeks
Brain morphology1
Decreased
Description: Decreased cortical thickness in layers ii/iii of somatosensory cortex
Exp Paradigm: Morphometric analysis with a dxm-1220f system of coronal sections
 Histology
 6 weeks
Brain morphology1
Increased
Description: Increased neuronal density in layers ii/iii and v of the somatosensory and motor cortices
Exp Paradigm: Morphometric analysis with a dxm-1220f system of coronal sections
 Histology
 4-6 weeks
Brain morphology1
Decreased
Description: Decreased number of parvalbumin (pv)-positive cells in cortex
Exp Paradigm: Parvalbumin (pv) immunohistochemistry in somatosensory cortex
 Immunohistochemistry
 Unreported
Synaptic morphology1
Decreased
Description: Decreased synaptic maturation in layers ii/iii of somatosensory cortex
Exp Paradigm: Electron microscopy analysis
 Electron microscopy
 P14
Brain morphology1
Decreased
Description: Decreased neuronal size of pyramidal cells in layers ii/iii and v of the somatosensory and motor cortices
Exp Paradigm: Morphometric analysis with a dxm-1220f system of coronal sections
 Histology
 6 weeks
Event related potential (erp) in electroencephalography (eeg)2
Decreased
Description: Decreased event-related power in both low and high frequency oscillations
Exp Paradigm: Time frequency analysis on eeg recordings
 Electroencephalogram (eeg)
 3 months
Event related potential (erp) in electroencephalography (eeg)2
Abnormal
Description: Abnormal eeg recordings indicated by increased power of high-gamma frequency oscillations
Exp Paradigm: Eeg recordings in awake, freely mobile
 Electroencephalogram (eeg)
 3 months
Event related potential (erp) in electroencephalography (eeg)2
Increased
Description: Increased latency of initial positive peak, negative peak and a subsequent second positive peak
Exp Paradigm: Eeg recordings following presentatino of a series of white noise clicks
 Electroencephalogram (eeg)
 3 months
Mortality/lethality4
Increased
Description: Decreased lifespan (no mice survive at 140 days old)
Exp Paradigm: General observations
 General observations
 0-4.5 months
Mortality/lethality3
Increased
Description: Decreased life span
Exp Paradigm: General observations
 General observations
 Unreported
Anxiety2
Decreased
Description: Decreased anxiety indicated by more time spent in open vs. closed arm
Exp Paradigm: Elevated zero maze test
 Elevated zero maze test
 9 weeks
Cued or contextual fear conditioning2
Decreased
Description: Decreased learning and memory indicated by decreased context-dependent and cue-dependent freezing
Exp Paradigm: Contextual and cued fear-conditioning procedure
 Fear conditioning test
 10 weeks
Gene expression3
Abnormal
Description: Decreased expression of hap1 and sgk1; increased expressionof itpr1 in medulla oblongata
Exp Paradigm: Dna microarray
 Gene expression microarray
 8 weeks
Signaling3
Decreased
Description: Decreased mrna expression of htt, hap1, dctn2, dync1h1, ahi in rostral brain regions
Exp Paradigm: Bdnf neuronal trafficking genes expression
 Quantitative pcr (qrt-pcr)
 8 weeks
Gene expression3
Decreased
Description: Decreased expression of hap1 and htt in the medulla oblongata, pons, and rostral brain
Exp Paradigm: Hap1/htt mrna expression
 Quantitative pcr (qrt-pcr)
 8 weeks
Gene expression3
Decreased
Description: Decreased sgk1 mrna expression in medulla oblongata
Exp Paradigm: Sgk1 mrna expression
 Quantitative pcr (qrt-pcr)
 8 weeks
Gene expression3
Decreased
Description: Decreased bdnf mrna expression in medulla oblongata, pons, and rostral brain
Exp Paradigm: Bdnf mrna expression
 Quantitative pcr (qrt-pcr)
 8 weeks
Gene expression3
Decreased
Description: Decreased hap1 mrna expression in medulla oblongata
Exp Paradigm: Hap1 mrna expression
 Quantitative pcr (qrt-pcr)
 8 weeks
Gene expression3
 No change
 Quantitative pcr (qrt-pcr)
 7.5 weeks
Gene expression3
 No change
 Quantitative pcr (qrt-pcr)
 4 weeks
Gene expression3
 No change
 Quantitative pcr (qrt-pcr)
 4 weeks
Neurotransmitter release: neurotrophins3
 No change
 Quantitative pcr (qrt-pcr)
 7.5 weeks
Hearing2
 No change
 Auditory brainstem response test
 4-12 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Motor phenotype, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_11_KO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Motor coordination and balance1
Decreased
Description: Decreased muscle coordination
Exp Paradigm: Rota-rod test for motor performance and coordination (male)
 Accelerating rotarod test
 Unreported
Motor coordination and balance1
Decreased
Description: Decreased cerebellar learning ability
Exp Paradigm: Rota-rod test performance over successive trials test for cerebellar learning (male)
 Accelerating rotarod test
 Unreported
General locomotor activity1
Decreased
Description: Decreased locomotor activity
Exp Paradigm: Activity on freewheel test (male)
 Running wheel test
 Unreported
Anxiety1
Decreased
Description: Decreased levels of anxiety demonstrated by increased time spent in open arms and center region
Exp Paradigm: Elevated plus maze test (male)
 Elevated plus maze test
 Unreported
Cued or contextual fear conditioning1
Decreased
Description: Decreased fear conditioning and contextual association
Exp Paradigm: Cued and contextual fear task: freezing response to previously cued audible tone associated with foot shock (male)
 Fear conditioning test
 Unreported
Transcriptome diversity1
Abnormal
Description: Abnormal gene expression profile: increase expression: sgk, sap30, pdk4. decreased expression: fabp7, his2b, nrarp, gap43, kif1b, lin7b, zfp40
Exp Paradigm: Gene expression profile
 Quantitative pcr (qrt-pcr)
 Unreported
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_1.2_KO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Synaptic transmission2
Increased
Description: Increased amplitude and frequency of miniature epsc's
Exp Paradigm: Electrophysiological recordings of epsc evoked by stimulation of ts at 20 hz with ttx and bicuuciline application
 Whole-cell patch clamp
 5-7 weeks
Miniature post synaptic current amplitude: excitatory2
Abnormal
Description: Abnormal synaptic function demonstrated by increased ts-epsc amplitude
Exp Paradigm: Epsc recordings after stimulation of fibers of horizontal brain stem slices
 Whole-cell patch clamp
 5-7 weeks
Action potential property: firing rate2
Increased
Description: Increased action potential firing probability
Exp Paradigm: Epsc recordings in response to 20 hz stimulation of nts neurons in horizontal brain slices
 Whole-cell patch clamp
 5-7 weeks
Respiratory function1
Abnormal
Description: Mecp2 null mice have a disordered breathing pattern characterized by a highly variable frequency and occasional long breathing pauses compared to wt littermates.
Exp Paradigm: NA
 Whole body plethysmography
 5 weeks
Respiratory function1
Increased
Description: The mean respiratory frequency is very high in mecp2 null mice compared to wt controls , arising of repetitive episodes of very high breathing frequency. therefore the minute volume/ weight is increased in mecp2 null mcie
Exp Paradigm: Tidal volume/ weight and minute volume/weight (tidal volume/weight x breathing frequency) were estimated
 Whole body plethysmography
 5 weeks
Protein expression level evidence2
Decreased
Description: Decreased bndf staining in perikarya and fibers of dorsal motor nucleus of vagus nerve, nts, area postrema, nucleus ambiguus, medullary reticular nuclei
Exp Paradigm: Bdnf protein expression
 Immunohistochemistry
 5 weeks
Protein expression level evidence1
Decreased
Description: Bdnf levels in vehicle injected mecp2 null mice was significantly reduced in the nodose cranial sensory ganglia neurons , compared to vehicle injected wild type controls
Exp Paradigm: Protein expression
 Elisa
 5 weeks
Gene expression1
Decreased
Description: Mrna levels of brain derived neurotrophic factor (bdnf) containing exons 2, 4 or 5 are reduced in the neurons from the nodose cranial sensory ganglia (ngs) derived from mecp2 null mice
Exp Paradigm: Gene expression
 Quantitative pcr (qrt-pcr)
 5 weeks
Action potential property: after hyperpolarization2
 No change
 Whole-cell patch clamp
 5-7 weeks
Action potential property: amplitude2
 No change
 Whole-cell patch clamp
 5-7 weeks
Action potential property: firing rate2
 No change
 Whole-cell patch clamp
 5-7 weeks
Action potential property: half-width2
 No change
 Whole-cell patch clamp
 5-7 weeks
Action potential property: threshold2
 No change
 Whole-cell patch clamp
 5-7 weeks
Intrinsic membrane properties2
 No change
 Whole-cell patch clamp
 5-7 weeks
Membrane potential2
 No change
 Whole-cell patch clamp
 5-7 weeks
Synaptic transmission: inhibitory2
 No change
 Whole-cell patch clamp
 5-7 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Emotion, Immune response, Learning & memory, Maternal behavior, Motor phenotype, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_7_KI_HE_S80A

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity1
Decreased
Description: Decreased locomotor activity
Exp Paradigm: Dark cycle running wheel analysis
 Running wheel test
 Unreported
Size/growth1
Increased
Description: Increased average body weight
Exp Paradigm: General observations
 General observations
 Unreported
Transcriptome diversity1
Abnormal
Description: Increased expression of rab3b, vamp3, igsf4b genes;
Exp Paradigm: Gene expression profile
 Western blot
 Unreported
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_8_CKD_HM_PYRAMIDALN-L2-3

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Synaptic transmission: excitatory1
Decreased
Description: Decreased excitatory input to neurons in l2/3 and l3/5a
Exp Paradigm: Glutamate uncaging and laser scanning photostimulation (lsps) of cortical slices and recording on neuron whose inputs are mapped
 Laser scanning photostimulation
 Unreported
Action potential property: firing rate1
 No change
 Whole-cell patch clamp
 3-4 weeks
Epsp-spike relationship1
 No change
 Whole-cell patch clamp
 3-4 weeks
Intrinsic membrane properties1
 No change
 Whole-cell patch clamp
 3-4 weeks
Membrane potential1
 No change
 Whole-cell patch clamp
 3-4 weeks
Synaptic transmission: inhibitory1
 No change
 Laser scanning photostimulation
 Unreported
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Motor phenotype, Neuroanatomy / ultrastructure / cytoarchitecture, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_1.2_CKO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Motor coordination and balance1
Decreased
Description: Decreased muscle coordination
Exp Paradigm: Dowel walking test
 Dowel walk test
 16 weeks
General locomotor activity1
Decreased
Description: Decrease locomotor activity demonstrated by decreased total distance and vertical activity
Exp Paradigm: Open field test
 Open field test
 15 weeks
Neurotransmitter release1
Decreased
Description: Decreased levels of dopamine and norepinephrine neurotransmitters; no change in serotonin levels
Exp Paradigm: Whole-brain hplc
 High-performance liquid chromatography (hplc)
 5 months
Respiratory function1
Abnormal
Description: Abnormal breathing phenotype demonstrated by increased number of apnea episodes
Exp Paradigm: Whole-body plesmythographic measurements
 Whole body plethysmography
 16 weeks
Gene expression1
Decreased
Description: Decreased expression level of tyrosine hydroxylase (th)
Exp Paradigm: Th/tph2 rna expression
 In situ hybridization (ish)
 16-20 weeks
Anxiety1
 No change
 Light-dark exploration test
 12-14 weeks
Cued or contextual fear conditioning1
 No change
 Fear conditioning test
 4.5 months
Motor coordination and balance1
 No change
 Accelerating rotarod test
 13 weeks
Social interaction1
 No change
 Partition test
 5 months
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Physiological parameters, Repetitive behavior, Seizure, Sensory

M_MECP2_1.3_CKO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Neurotransmitter release: serotonin1
Decreased
Description: Decreased levels of serotonergic neurotransmitters; no change in dopamine and norepinephrine levels
Exp Paradigm: Whole-brain hplc
 High-performance liquid chromatography (hplc)
 5 months
Aggression1
Increased
Description: Increased aggression levels
Exp Paradigm: Resident-intruder test
 Resident-intruder test
 5 months
Respiratory function1
Abnormal
Description: Abnormal breathing phenotype demonstrated by increased number of apnea episodes
Exp Paradigm: Whole-body plesmythographic measurements
 Whole body plethysmography
 6.5 months
Gene expression1
Decreased
Description: Decreased expression level of tryptophan hydroxylase 2 (tph2)
Exp Paradigm: Th/tph2 rna expression
 In situ hybridization (ish)
 3.5-4.5 months
Anxiety1
 No change
 Light-dark exploration test
 12-14 weeks
General locomotor activity1
 No change
 Open field test
 Unreported
Motor coordination and balance1
 No change
 Accelerating rotarod test
 13 weeks
Motor coordination and balance1
 No change
 Dowel walk test
 16 weeks
Self grooming: artificial stress evoked1
 No change
 Splash test to evoke grooming behavior
 7 months
Repetitive digging1
 No change
 Marble-burying test
 8 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Learning & memory, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Physiological parameters, Seizure, Sensory

M_MECP2_14_KI_HE_A140V

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Dendritic architecture: spine density1
Decreased
Description: Decreased dendritic complexity of layer ii/iii pyramidal neurons of the somatosensory cortex
Exp Paradigm: Sholl analysis on z-stack images of golgi-cox stained layer ii-iii pyramidal neurons from the somatosensory cortex
 Sholl analysis
 2-3 months
Brain cytoarchitecture1
Increased
Description: Increased packing density in the frontal cortex, olfactory bulbs, dentate gyrus and regions ca1, ca2, ca3 of hippocampus; increased density of cell nuclei in a140v cerebellar granule layer
Exp Paradigm: Histological analysis using cresyl violet staining
 Histology
 5 months
General characteristics1
 No change
 General observations
 14 months
Mortality/lethality1
 No change
 General observations
 14 months
Size/growth1
 No change
 General observations
 6-18 weeks
Gene expression1
 No change
 Quantitative pcr (qrt-pcr)
 6 months
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Motor phenotype, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_14_KI_HT_A140V

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General characteristics1
 No change
 General observations
 6-18 weeks
Mortality/lethality1
 No change
 General observations
 14 months
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Motor phenotype, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_5.7_CKO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Motor coordination and balance1
Abnormal
Description: Abnormal muscle coordination demonstrated by increased foot slips
Exp Paradigm: Wire grid assay
 Footslip test
 5 weeks
Motor coordination and balance1
Abnormal
Description: Abnormal muscle coordination demonstrated by impaired dowel walk
Exp Paradigm: Dowel walking test
 Dowel walk test
 9 weeks
Motor coordination and balance1
Abnormal
Description: Abnormal muscle coordinaion demonstrated by shorter latency to fall on an accelerating rotarod
Exp Paradigm: Accelerating rotarod test
 Accelerating rotarod test
 19 weeks
Stereotypy1
Increased
Description: Increased forelimb stereotypies reminiscent of mid-line hand wringing
Exp Paradigm: NA
 General observations
 Unreported
Head bobbing1
Increased
Description: Increased head bobbing stereotypy
Exp Paradigm: Holeboard assay
 Hole-board test
 Unreported
Startle response: acoustic stimulus1
Decreased
Description: Decreased startle response: acoustic stimulus response to 120 db
Exp Paradigm: Response to 120 db white noise stimulus
 Startle response test
 8 weeks
Sensorimotor gating1
Increased
Description: Increased prepulse inhibition at 78 and 82 db prepulses demonstrating dysfunction of sensorimotor gating
Exp Paradigm: Prepulse inhibtion of the startle response: acoustic stimulus
 Prepulse inhibition
 8 weeks
Social interaction1
Increased
Description: Increased interaction with partner mouse through sniffing, pawing, or rearing
Exp Paradigm: Partition test for social interest
 Partition test
 12-13 weeks
Mortality/lethality1
 No change
 General observations
 18 months
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Seizure

M_MECP2_5.8_CKO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Gene expression1
 No change
 Quantitative pcr (qrt-pcr)
 Unreported
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Emotion, Immune response, Learning & memory, Maternal behavior, Motor phenotype, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_5.9_CKO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Motor coordination and balance1
Abnormal
Description: Abnormal muscle coordinaion demonstrated by shorter latency to fall on an accelerating rotarod
Exp Paradigm: Accelerating rotarod test
 Accelerating rotarod test
 19 weeks
Self grooming: home cage/familiar environment1
Increased
Description: Increased self grooming behavior leading to fur loss and epidermal lesions
Exp Paradigm: General observations
 General observations
 Unreported
Grip strength1
Decreased
Description: Decreased grip/muscle strength demonstrated by decreased latency to fall on a wire hang
Exp Paradigm: Hanging wire assay
 Wire hang test
 9 weeks
Motor coordination and balance1
Abnormal
Description: Abnormal muscle coordination demonstrated by increased foot slips
Exp Paradigm: Wire grid assay
 Footslip test
 5 weeks
General locomotor activity1
Decreased
Description: Decreased locomotor activtivity leading to hypactivity
Exp Paradigm: Open field test
 Open field test
 12-19 weeks
Motor coordination and balance1
Abnormal
Description: Abnormal muscle coordination demonstrated by impaired dowel walk
Exp Paradigm: Dowel walking test
 Dowel walk test
 9 weeks
Synaptic transmission1
Decreased
Description: Decreased amplitude and charge of mipscs in layer 2/3 pyramidal neurons of the somatosensory cortex
Exp Paradigm: NA
 Whole-cell patch clamp
 Unreported
Synaptic plasticity: hippocampal ltp1
Decreased
Description: Decreased long-term potentiation (ltp) induced by theta-burst stimulation of schaffer collateral synapses
Exp Paradigm: NA
 Long term potentiation (ltp)
 Unreported
Neurotransmitter release1
Decreased
Description: Decreased gaba content in layer 2/3 cortical neurons and striatal medium spiny neurons
Exp Paradigm: Somatic gaba content
 Immunohistochemistry
 15-17 weeks
Head bobbing1
Increased
Description: Increased head bobbing stereotypy
Exp Paradigm: Holeboard assay
 Hole-board test
 Unreported
Stereotypy1
Increased
Description: Increased forelimb stereotypies reminiscent of mid-line hand wringing
Exp Paradigm: General observations
 General observations
 Unreported
Seizures1
Abnormal
Description: Abnormal seizure activity demonstrating frequenct hyperexcitability discharges with no electrographic seizures
Exp Paradigm: Eeg recordings
 Electroencephalogram (eeg)
 9 weeks
Sensorimotor gating1
Increased
Description: Increased prepulse inhibition at 78 and 82 db prepulses demonstrating dysfunction of sensorimotor gating
Exp Paradigm: Prepulse inhibtion of the startle response: acoustic stimulus
 Prepulse inhibition
 8 weeks
Startle response: acoustic stimulus1
Decreased
Description: Decreased startle response: acoustic stimulus response to 120 db
Exp Paradigm: Response to 120 db white noise stimulus
 Startle response test
 8 weeks
Social interaction1
Increased
Description: Increased interaction with partner mouse through sniffing, pawing, or rearing
Exp Paradigm: Partition test for social interest
 Partition test
 12-13 weeks
Nest building behavior1
Decreased
Description: Decreased nest building ability
Exp Paradigm: General observations
 General observations
 13 weeks
Mortality/lethality1
Increased
Description: Increased lethality after a period of marked weight loss and severe respiratory dysfunction
Exp Paradigm: Survival analysis
 Survival analysis
 6.5 months
Spatial reference memory1
Decreased
Description: Decreased spatial reference memory demonstrated by difficulty locating the platform
Exp Paradigm: Morris water maze task
 Morris water maze test
 11 weeks
Olfactory learning and memory1
Increased
Description: Increased time sniffing vanilla than controls
Exp Paradigm: NA
 Olfactory habituation-dishabituation test
 Unreported
Gene expression1
Decreased
Description: Decreased mrna levels of gad1 and gad 2 in cortex and striatum
Exp Paradigm: Gad1 and gad2 mrna levels
 Quantitative pcr (qrt-pcr)
 Unreported
Anxiety1
 No change
 Open field test
 Unreported
Presynaptic function: paired-pulse facilitation1
 No change
 Paired-pulse ratio
 Unreported
Social approach1
 No change
 Three-chamber social approach test
 11-12 weeks
Social scent marking or recognition1
 No change
 Olfactory habituation-dishabituation test
 Unreported
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Physiological parameters

M_MECP2_20_KI_HE_T158A

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Motor coordination and balance1
Decreased
Description: Decreased motor coordination and motor learning
Exp Paradigm: Rotarod test
 Accelerating rotarod test
 Unreported
General locomotor activity1
Decreased
Description: Decreased locomotor activity
Exp Paradigm: Open field test
 Open field test
 9, 11 weeks
Brain size1
Decreased
Description: Decreased size and weight of brains
Exp Paradigm: NA
 Measurement of tissue weight
 4,13 weeks
Brain cytoarchitecture1
Decreased
Description: Decreased soma size in hippocampal ca1 region
Exp Paradigm: Confocal imaging anlysis of gfp-positive pyramidal neurons
 Confocal microscopy
 4,13 weeks
Event related potential (erp) in electroencephalography (eeg)1
Abnormal
Description: Abnormal eeg recordings indicated by increased power of high-gamma frequency oscillations
Exp Paradigm: Eeg recordings in awake, freely mobile
 Electroencephalogram (eeg)
 3 months
Event related potential (erp) in electroencephalography (eeg)1
Increased
Description: Increased latency of initial positive peak, negative peak and a subsequent second positive peak
Exp Paradigm: Eeg recordings following presentatino of a series of white noise clicks
 Electroencephalogram (eeg)
 3 months
Event related potential (erp) in electroencephalography (eeg)1
Decreased
Description: Decreased reduction in event related power in low frequency gamma, theta, and alpha
Exp Paradigm: Time frequency analysis on eeg recordings
 Electroencephalogram (eeg)
 4 weeks
Event related potential (erp) in electroencephalography (eeg)1
Decreased
Description: Decreased event-related power in both low and high frequency oscillations
Exp Paradigm: Time frequency analysis on eeg recordings
 Electroencephalogram (eeg)
 13 weeks
Size/growth1
Decreased
Description: Decreased body weight
Exp Paradigm: Male mice: general observation
 General observations
 4 weeks
Mortality/lethality1
Increased
Description: Increased lethality
Exp Paradigm: Male mice: general observation
 General observations
 16 weeks
Developmental trajectory1
Abnormal
Description: Abnormal developmental trajectory with progressive symptomology
Exp Paradigm: Male mice: general observation
 General observations
 5 weeks
Anxiety1
Decreased
Description: Decreased anxiety indicated by more time spent in open vs. closed arm
Exp Paradigm: Elevated zero maze test
 Elevated zero maze test
 9 weeks
Cued or contextual fear conditioning1
Decreased
Description: Decreased learning and memory indicated by decreased context-dependent and cue-dependent freezing
Exp Paradigm: Contextual and cued fear-conditioning procedure
 Fear conditioning test
 10 weeks
Protein expression level evidence1
Decreased
Description: Decreased mecp2 protein expression
Exp Paradigm: Mecp2 protein expression
 Western blot
 P2, 1, 3 months
Targeted expression1
Abnormal
Description: Abnormally diffuse mecp2 immunoreactivity throughout nucleus with clear absence of co-localization with dna
Exp Paradigm: Mecp2 immunoreactivity
 Confocal microscopy
 1 month, 3 months
Gene expression1
Decreased
Description: Decreased transcription of bdnf and crh in hypothalamus but not striatum
Exp Paradigm: Transcriptional profiling
 Quantitative pcr (qrt-pcr)
 Unreported
Protein-dna complex assembly1
Decreased
Description: Decreased binding of of mecp2 across the entire locus
Exp Paradigm: Mecp2 binding
 Quantitative pcr (qrt-pcr)
 Unreported
Targeted expression1
Decreased
Description: Decreased interaction with hdac1 and sin3a
Exp Paradigm: Mecp2 immunoreactivity-immunoprecipitation
 Immunoprecipitation
 Unreported
Protein-dna complex assembly1
Decreased
Description: Decreased affinity of mecp2 to methylated dna indicated by more readily extraction under low salt conditions
Exp Paradigm: Mecp2 affinity to methylated dna
 Western blot
 Unreported
Targeted expression1
Decreased
Description: Decreased interaction with hdac1 and sin3a
Exp Paradigm: Mecp2 immunoreactivity- western blot: anti-mecp2 antibody/anti-hdac1 or anti-sin3a antibody
 Western blot
 Unreported
General characteristics1
 No change
 General observations
 4 weeks
Size/growth1
 No change
 General observations
 8 weeks
Gene expression1
 No change
 Quantitative pcr (qrt-pcr)
 P0, 1,3 months
General locomotor activity1
 No change
 Open field test
 3 weeks
Brain anatomy1
 No change
 Histology
 Unreported
Event related potential (erp) in electroencephalography (eeg)1
 No change
 Electroencephalogram (eeg)
 4 weeks
Event related potential (erp) in electroencephalography (eeg)1
 No change
 Electroencephalogram (eeg)
 4 weeks
Hearing1
 No change
 Auditory brainstem response test
 1-3 months
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Maternal behavior, Physiological parameters, Repetitive behavior, Seizure, Social behavior

M_MECP2_20_KI_HT_T158A

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity1
Decreased
Description: Decreased locomotor activity
Exp Paradigm: Open field test
 Open field test
 4.5 months
Size/growth1
Increased
Description: Increased body weight
Exp Paradigm: Female mice: general observation
 General observations
 17 weeks
Targeted expression1
Abnormal
Description: Abnormally diffuse mecp2 immunoreactivity throughout nucleus with clear absence of co-localization with dna
Exp Paradigm: Mecp2 immunoreactivity
 Confocal microscopy
 1 month, 3 months
Protein expression level evidence1
Decreased
Description: Decreased mecp2 protein expression
Exp Paradigm: Mecp2 protein expression
 Western blot
 3 months
Developmental trajectory1
 No change
 General observations
 4 months
General locomotor activity1
 No change
 Open field test
 12 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_5.2_KO_HE_CORTISONE-H

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Motor coordination and balance1
Decreased
Description: Decreased motor coordination indicated by rotarod test performance
Exp Paradigm: Rotarod test
 Accelerating rotarod test
 6-8 weeks
General locomotor activity1
Decreased
Description: Decreased general locomotor activity as indicated by decreased travelled distance
Exp Paradigm: Open field test
 Open field test
 6-8 weeks
Mortality/lethality1
Increased
Description: Decreased lifespan is refractoryto the treatment (31% decrease in mean life expectancy of mecp2/y mice)
Exp Paradigm: General observations
 General observations
 0-4.5 months
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_5.2_KO_HE_CORTISONE-L

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Mortality/lethality1
Increased
Description: Decreased lifespan is seen in cortisone treated male mecp2 hemizygotes, 26% decrease in mean life expectancy of mecp2-/y mice
Exp Paradigm: General observations
 General observations
 0-4.5 months
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Motor phenotype, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_5.2_KO_HT_CORTISONE-H

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Clasping reflex1
Increased
Description: Abnormal hindlimb clasping is displayed significantly earlier after treatment with cortisone
Exp Paradigm: General observations in separate cage
 General observations
 0-7.5 months
Gene expression1
Increased
Description: Increased expression of genes fkbp5 and sgk1 in brain is refractoryto the treatment (higher than one without the treatment)
Exp Paradigm: Fkbp5 and sgk1 gene expression
 Quantitative pcr (qrt-pcr)
 5 weeks
Mortality/lethality1
 No change
 General observations
 5.5 months
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_5.2_KO_HT_CORTISONE-L

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Tremor1
Increased
Description: Abnormal tremor displays earlier onset in females treated with cortisone
Exp Paradigm: General observations in separate cage
 General observations
 0-10 months
Clasping reflex1
Increased
Description: Abnormal hindlimb clasping is refractoryto the treatment (significantly earlier onset than one without treatment)
Exp Paradigm: General observations in separate cage
 General observations
 0-7.5 months
Mortality/lethality1
 No change
 General observations
 5.5 months
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_1.3_KO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity1
Decreased
Description: Decreased voluntary locomotor activity
Exp Paradigm: Voluntary wheel-running activity
 Running wheel test
 8 weeks
Motor coordination and balance2
Decreased
Description: Decreased motor coordination
Exp Paradigm: Rotarod test
 Accelerating rotarod test
 6 weeks
General locomotor activity2
Decreased
Description: Decreased locomotor activity with steady hypoactivity across testing period
Exp Paradigm: General motor activity levels during dark cycle
 Light-dark exploration test
 3, 4, 6 weeks
Grip strength2
Decreased
Description: Decreased forepaw grip strength
Exp Paradigm: Grip strength assay
 Grip strength test
 3, 4, 6 weeks
Gait3
Decreased
Description: Mecp2 homozygous null mice show decreased gait score compared to previously published controls.
Exp Paradigm: Walking gait was assessed using an observational scoring system while mice walked on a flat table top. a score of 0 indicated normal gait, 1 indicated hind legs spread wider than normal when ambulating, 2 indicated severe abnormality either with tremor when feet were lifted or with backwards walking by lifting both rear feet simultaneously.
 Gait
 4 months
General locomotor activity: ambulatory activity3
Decreased
Description: Mecp2 homozygous null mice show reduced number of beam breaks compared to previously published controls.
Exp Paradigm: Locomotor activity was determined for 8 hours during the active nocturnal phase of mice.
 Open field test
 4 months
Brain cytoarchitecture1
Decreased
Description: Decreased hippocampal neuronal nuclei size
Exp Paradigm: Ca1 neuronal nuclei size measurement
 Nuclear size measurement
 8-10 weeks
Dendritic architecture: spine density2
Abnormal
Description: Abnormal dendritic cell morphology indicated by smaller cell body size and shorter dendritic lengths
Exp Paradigm: Sholl analysis of cell morphology in the dentate gyrus of the hippocampus
 Sholl analysis
 Unreported
Synaptic plasticity: cerebellar ltp
Decreased
Description: Mecp2 homozygous null mice show decreased high-frequency induced ltp in hippocampal slices compared to controls.
Exp Paradigm: An input stimulus intensity that induces 4060% of the maximum response was used for measuring long-term potentiation (ltp). after 20 minutes of stable baseline, ltp was induced by high frequency stimulation using an input stimulus intensity that produces the maximum response (hfs, 2 100 hz trains with 100 pulses with an inter- burst interval of 20 seconds).
 Field potential recordings
 4 months
Neurotransmitter release: neurotrophins2
Increased
Description: Increased expression of ngf is seen in the striatum
Exp Paradigm: Bdnf/ngf elisa's
 Immunohistochemistry
 6 weeks
Presynaptic function: paired-pulse facilitation3
Decreased
Description: Mecp2 homozygous null mutants show decreased ppr compared to controls.
Exp Paradigm: An input stimulus intensity that induces 4060% of the maximum response was used for measuring paired-pulse ratios (ppr). ppr was measured by giving 2 pulses at decreasing interstimulus intervals (500, 400, 200, 100, 50, 30, 20 ms) and analyzed by dividing the fepsp slope of pulse 2 by pulse 1.
 Field potential recordings
 4 months
Neurotransmitter release: neurotrophins2
Decreased
Description: Abnormal bdnf/ngf expression with decreased levels of bdnf in cerebellum and increased ngf in striatum
Exp Paradigm: Bdnf/ngf elisa's
 Immunohistochemistry
 NA
Neurotransmitter release: neurotrophins3
Decreased
Description: Mecp2 homozygous null mice displayed reduced amount of total bdnf protein in the brainstem and striatum compared to controls. mecp2 homozygous null mice displayed reduced amount of mature bdnf in the brainstem, striatum and hippocampus compared to controls. mecp2 homozygous null mice displayed reduced amounts of pro-bdnf in the brainstem and striatum compared to controls.
Exp Paradigm: Total, mature and pro-bdnf protein levels was measured with recombinant mature bdnf as a standard.-elisa
 Elisa
 4 months
Neurotransmitter release: neurotrophins3
Decreased
Description: Mecp2 homozygous null mice displayed reduced amount of total bdnf protein in the brainstem and striatum compared to controls. mecp2 homozygous null mice displayed reduced amount of mature bdnf in the brainstem, striatum and hippocampus compared to controls. mecp2 homozygous null mice displayed reduced amounts of pro-bdnf in the brainstem and striatum compared to controls.
Exp Paradigm: Total, mature and pro-bdnf protein levels was measured with recombinant mature bdnf as a standard.- western blot
 Western blot
 4 months
Respiratory function1
Increased
Description: Increased ventilatory capacity as measured by tidal volume and minute pulmonary ventilation
Exp Paradigm: Whole-body plesmythographic measurements
 Whole body plethysmography
 6 weeks
Respiratory function1
Abnormal
Description: Abnormal breathing pattern as indicated by increased total duration of each breath and greater confidence interval and coefficient of variation
Exp Paradigm: Whole-body plesmythographic measurements
 Whole body plethysmography
 6 weeks
Metabolic function2
Decreased
Description: Decreased metabolic function indicated by decreased co2 production and lower o2 consumption
Exp Paradigm: Gas exchange measurements
 Measurement of gas exchange
 6 weeks
Respiratory function3
Decreased
Description: Mecp2 homozygous null mice show increased incidence of apnea compared to previously published controls.
Exp Paradigm: Apneas were defined as a pause in the breathing cycle lasting longer than 1.5 seconds.
 Whole body plethysmography
 4 months
Mortality/lethality3
Increased
Description: Mecp2 homozygous null mice show increased lethality compared to controls.
Exp Paradigm: NA
 General observations
 4 months
Mortality/lethality1
Increased
Description: Increased lethality
Exp Paradigm: General observations
 General observations
 7.5 days
Size/growth2
Decreased
Description: Decreased rate of weight gain starting just after weaning
Exp Paradigm: General observations
 General observations
 3 weeks
Mortality/lethality1
Increased
Description: Decreased lifespan
Exp Paradigm: General observations
 General observations
 Unreported
Size/growth1
Decreased
Description: Decreased body weight
Exp Paradigm: General observations
 General observations
 4-8 weeks
Object recognition memory2
Decreased
Description: Decreased long term memory demonstrated by no memory for object 1
Exp Paradigm: Object recognition task
 Novel object recognition test
 4 weeks
Cued or contextual fear conditioning2
Abnormal
Description: Abnormal cued/contextual conditioning demonstrated by deficit in cued but not contextual fear conditioning
Exp Paradigm: Associative fear conditioning task
 Fear conditioning test
 6 weeks
General characteristics3
 No change
 General observations
 4 months
Size/growth3
 No change
 Body weight measurement
 1-4 months
Object recognition memory2
 No change
 Novel object recognition test
 4 weeks
Clasping reflex3
 No change
 General observations
 4 months
Grip strength3
 No change
 Grip strength test
 4 months
Tremor3
 No change
 Tremor activity measurements
 4 months
Epsp-spike relationship
 No change
 Field potential recordings
 4 months
Neurotransmitter release: neurotrophins3
 No change
 Western blot
 4 months
Neurotransmitter release: neurotrophins3
 No change
 Elisa
 4 months
Metabolic function2
 No change
 Measurement of gas exchange
 3, 4 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_34.1_TG_2X

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Social approach1
Decreased
Description: Mecp2-tg mice (f1 fvb/n * 129s6/svev) spend less time investigating stimulus mouse compared to controls
Exp Paradigm: NA
 Three-chamber social approach test
 12 weeks
Social approach1
Decreased
Description: Mecp2-tg animals are less interested in their familiar or novel partner mice in the partition test for social interaction and recognition; in the three-chamber test for social approach, mecp2-tg mice compared to wild-type littermates spend the same amount of time investigating a novel object but are less interested in a novel mouse;
Exp Paradigm: Partition test
 Three-chamber social approach test
 7 weeks
Social memory1
Decreased
Description: Mecp2-tg mice (f1 fvb/n * 129s6/svev) spend similar amount of time with novel and familiar mouse indicating impaired memory
Exp Paradigm: NA
 Partition test
 12-13 weeks
Social interaction1
Decreased
Description: Mecp2-tg mice (f1 fvb/n * 129s6/svev) spend less time at the partitition with a stimulus mouse compared to controls
Exp Paradigm: NA
 Partition test
 12-13 weeks
Anxiety1
Increased
Description: Mecp2-tg, f1 hybrid background (fvb/n * 129+h1575:h1608s6/svev) mice display increased anxiety and spend less time in the open arms of elevated plus maze and in the lit compartment of the light-dark box compared to respective wild-type littermate animals
Exp Paradigm: Elevated plus maze test
 Elevated plus maze test
 9-10 weeks
Anxiety1
Increased
Description: Mecp2-tg mice compared to respective wild-type littermate animals spend less time in the open arms of an elevated plus maze and spend less time in the lit compartment of the light-dark box;
Exp Paradigm: Light-dark exploration test; males only tested;-light-dark exploration test
 Light-dark exploration test
 7 weeks
Anxiety1
Increased
Description: Mecp2-tg mice compared to respective wild-type littermate animals spend less time in the open arms of an elevated plus maze and spend less time in the lit compartment of the light-dark box;
Exp Paradigm: Light-dark exploration test; males only tested;- elevated plus maze test
 Elevated plus maze test
 7 weeks
Anxiety1
Increased
Description: Mecp2-tg, f1 hybrid background (fvb/n * 129+h1575:h1608s6/svev) mice display increased anxiety and spend less time in the open arms of elevated plus maze and in the lit compartment of the light-dark box compared to respective wild-type littermate animals
Exp Paradigm: Light-dark exploration test
 Light-dark exploration test
 9-10 weeks
Gene expression1
Abnormal
Description: Gene expression analysis of the amygdala identifies a subset of altered genes implicated in anxiety and/or social behavior in mecp2-tg mice compared to wildtype control littermates
Exp Paradigm: Quantitative pcr (qrt-pcr);
 Quantitative pcr (qrt-pcr)
 6 weeks
Exploratory activity: habituation1
 No change
 Three-chamber social approach test
 12 weeks
General locomotor activity1
 No change
 Open field test
 8-9 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Learning & memory, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory

M_MECP2_34.2_TG_2X

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Social memory1
Decreased
Description: Mecp2-tg mice, (f1 fvb/n * c57bl/6) spend similar amount of time with novel and familiar mouse indicating impaired memory
Exp Paradigm: NA
 Partition test
 12-13 weeks
Social interaction1
Decreased
Description: Mecp2-tg mice, (f1 fvb/n * c57bl/6) spend less time at the partitition with a stimulus mouse spend less time at the partitition compared to controls
Exp Paradigm: NA
 Partition test
 12-13 weeks
Social approach1
Decreased
Description: Mecp2-tg mice, (f1 fvb/n * c57bl/6) spend less time investigating stimulus mouse compared to controls
Exp Paradigm: NA
 Three-chamber social approach test
 12 weeks
Hormone levels1
Increased
Description: Mecp2-tg mice show increased serum levels of corticosterone after exposure to stress, compared to wild type littermates
Exp Paradigm: NA
 Restraint-stress induced corticosterone levels
 4-5 months
Anxiety1
Increased
Description: Mecp2-tg mice, (f1 fvb/n * c57bl/6), display increased anxiety and spend less time in the open arms of elevated plus maze and in the lit compartment of the light-dark box compared to respective wild-type littermate animals
Exp Paradigm: Light-dark exploration test
 Light-dark exploration test
 9-10 weeks
Anxiety1
Increased
Description: Mecp2-tg mice, (f1 fvb/n * c57bl/6), display increased anxiety and spend less time in the open arms of elevated plus maze and in the lit compartment of the light-dark box compared to respective wild-type littermate animals
Exp Paradigm: Elevated plus maze test
 Elevated plus maze test
 9-10 weeks
Exploratory activity: habituation1
 No change
 Three-chamber social approach test
 12 weeks
General locomotor activity1
 No change
 Open field test
 8-9 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Motor phenotype, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_36.1_TG_7X

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity1
Decreased
Description: Mecp2-tg mice (f1 fvb/n * 129s6/svev), with more than 3 fold increase in mecp2 protein levels, show significantly reduced activity in open field
Exp Paradigm: NA
 Open field test
 8-9 weeks
Social memory1
Decreased
Description: Mecp2-tg mice (f1 fvb/n * 129s6/svev) spend similar amount of time with novel and familiar mouse indicating impaired memory
Exp Paradigm: NA
 Partition test
 12-13 weeks
Social interaction1
Decreased
Description: Mecp2-tg mice (f1 fvb/n * 129s6/svev) spend less time at the partitition with a stimulus mouse compared to controls
Exp Paradigm: NA
 Partition test
 12-13 weeks
Social approach1
Decreased
Description: Mecp2-tg mice (f1 fvb/n * 129s6/svev) spend less time investigating stimulus mouse compared to controls
Exp Paradigm: NA
 Three-chamber social approach test
 12 weeks
Anxiety1
Increased
Description: Mecp2-tg mice (f1 fvb/n * 129s6/svev) display increased anxiety and spend less time in the open arms of elevated plus maze and in the lit compartment of the light-dark box compared to respective wild-type littermate animals
Exp Paradigm: Light-dark exploration test
 Light-dark exploration test
 9-10 weeks
Anxiety1
Increased
Description: Mecp2-tg mice (f1 fvb/n * 129s6/svev) display increased anxiety and spend less time in the open arms of elevated plus maze and in the lit compartment of the light-dark box compared to respective wild-type littermate animals
Exp Paradigm: Elevated plus maze test
 Elevated plus maze test
 9-10 weeks
Gene expression1
Increased
Description: Mecp2-tg mice, f1 hybrids have greater than 50% increase in the expression of fabp7 in the amygdala
Exp Paradigm: NA
 Quantitative pcr (qrt-pcr)
 6 weeks
Gene expression1
Increased
Description: Mecp2-tg mice, f1 hybrids have increased expression of adcyap1 in the amygdala
Exp Paradigm: NA
 Quantitative pcr (qrt-pcr)
 6 weeks
Gene expression1
Increased
Description: Mecp2-tg mice, f1 hybrids have increased in the expression of tacr3 in the amygdala
Exp Paradigm: NA
 Quantitative pcr (qrt-pcr)
 6 weeks
Gene expression1
Increased
Description: Mecp2-tg mice, f1 hybrids have greater than 50% increase in the expression of crh in the amygdala
Exp Paradigm: NA
 Quantitative pcr (qrt-pcr)
 6 weeks
Gene expression1
Increased
Description: Mecp2-tg mice, f1 hybrids have greater than 50% increase in the expression of htr1a in the amygdala
Exp Paradigm: NA
 Quantitative pcr (qrt-pcr)
 6 weeks
Gene expression1
Increased
Description: Mecp2-tg mice, f1 hybrids have greater than 50% increase in the expression of irs4 in the amygdala
Exp Paradigm: NA
 Quantitative pcr (qrt-pcr)
 6 weeks
Gene expression1
Increased
Description: Mecp2-tg mice, f1 hybrids have greater than 50% increase in the expression of grpr in the amygdala
Exp Paradigm: NA
 Quantitative pcr (qrt-pcr)
 6 weeks
Gene expression1
Increased
Description: Mecp2-tg mice, f1 hybrids have increased expression of npas1 in the amygdala
Exp Paradigm: NA
 Quantitative pcr (qrt-pcr)
 6 weeks
Exploratory activity: habituation1
 No change
 Three-chamber social approach test
 12 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Learning & memory, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory

M_MECP2_36.2_TG_7X

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity1
Decreased
Description: Mecp2-tg mice, (f1 fvb/n * c57bl/6) with more than 3 fold increase in mecp2 protein levels, show significantly reduced activity in open field
Exp Paradigm: NA
 Open field test
 8-9 weeks
Social memory1
Decreased
Description: Mecp2-tg mice, (f1 fvb/n * c57bl/6) spend similar amount of time with novel and familiar mouse indicating impaired memory
Exp Paradigm: NA
 Partition test
 12-13 weeks
Social interaction1
Decreased
Description: Mecp2-tg mice, (f1 fvb/n * c57bl/6) spend less time at the partitition with a stimulus mouse compared to controls
Exp Paradigm: NA
 Partition test
 12-13 weeks
Social approach1
Decreased
Description: Mecp2-tg mice, (f1 fvb/n * c57bl/6) spend less time investigating stimulus mouse compared to controls
Exp Paradigm: NA
 Three-chamber social approach test
 12 weeks
Anxiety1
Increased
Description: Mecp2-tg mice, (f1 fvb/n * c57bl/6), display increased anxiety and spend less time in the open arms of elevated plus maze and in the lit compartment of the light-dark box compared to respective wild-type littermate animals
Exp Paradigm: Light-dark exploration test
 Light-dark exploration test
 9-10 weeks
Anxiety1
Increased
Description: Mecp2-tg mice, (f1 fvb/n * c57bl/6), display increased anxiety and spend less time in the open arms of elevated plus maze and in the lit compartment of the light-dark box compared to respective wild-type littermate animals
Exp Paradigm: Elevated plus maze test
 Elevated plus maze test
 9-10 weeks
Exploratory activity: habituation1
 No change
 Three-chamber social approach test
 12 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Learning & memory, Maternal behavior, Molecular profile, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory

M_MECP2_23_KI_HT_TRUNC(308)_BDE47

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Size/growth1
Decreased
Description: Decreased body weight is a side effect of bde-47 treatment
Exp Paradigm: General observations
 General observations
 P8-p18
Spatial learning1
Decreased
Description: Decreased spatial reference memory as measured by increased latency to reach platform is a side effect of bde-47 treatment in female heterzygots
Exp Paradigm: Female mice: morris water maze task
 Morris water maze test
 7-12 weeks
Dna methylation1
Decreased
Description: Decreased dna methylation levels during global assessment is a side effec of bde-47 treatment in female heterzygots
Exp Paradigm: Dna methylation levels
 Dot-blot analysis
 Unreported
Gene expression1
Increased
Description: Increased transcript levels of dna methyltransferase family of genes (dnmt1 and dnmt3a) are side effects of bde-47 treatment in female heterozygots
Exp Paradigm: Dna methyltransferase gene levels
 Quantitative pcr (qrt-pcr)
 Unreported
Ultrasonic vocalization1
 No change
 Monitoring ultrasonic vocalizations
 P8-p16
General locomotor activity1
 No change
 Open field test
 NA
Social approach1
 No change
 Three-chamber social approach test
 5.5-10 weeks
Social memory1
 No change
 Three-chamber social approach test
 10 weeks
 Not Reported: Circadian sleep/wake cycle, Emotion, Immune response, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory

M_MECP2_4_KI_HE_TRUNC(308)

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity1
Decreased
Description: Decreased locomotor activity
Exp Paradigm: Open field test
 Open field test
 Unreported
Motor coordination and balance1
Decreased
Description: Decreased muscle coordination
Exp Paradigm: Wire suspension test
 Wire hang test
 3 months
Jerky movement1
Decreased
Description: Rapid and repetitive movement of forelimbs.
Exp Paradigm: Evaluation of movement when suspended by tail
 Tail suspension test
 Unreported
Motor coordination and balance1
Decreased
Description: Decreased muscle coordination exhibited by mice tending to drop off early from wire.
Exp Paradigm: Wire suspension test
 Wire hang test
 3 months
General locomotor activity1
Decreased
Description: Decreased general locomotor activity
Exp Paradigm: Activity chamber monitoring
 Open field test
 Unreported
Motor coordination and balance1
Decreased
Description: Decreased muscle coordination
Exp Paradigm: Vertical pole test
 Vertical pole test
 3 months
Jerky movement1
Increased
Description: Increased jerky movements
Exp Paradigm: Evaluation of movement when suspended by tail
 Tail suspension test
 Unreported
Motor coordination and balance1
Decreased
Description: Decreased muscle coordination exhibited by mice rapidly losing balance and falling off dowel.
Exp Paradigm: Motor coordination measured by ability of mice to remain on a horizontal dowel for 120 s
 Dowel walk test
 3 months
Motor coordination and balance1
Decreased
Description: Decreased muscle coordination
Exp Paradigm: Motor coordination measured by ability of mice to remain on a horizontal dowel for 120 s
 Dowel walk test
 3 months
General locomotor activity1
Decreased
Description: Lower activity as measured by total distance traveled and time spent moving
Exp Paradigm: Open field test
 Open field test
 Unreported
Motor coordination and balance1
Decreased
Description: Decreased muscle coordination exhibited by mice falling off pole more readily
Exp Paradigm: Vertical pole test
 Vertical pole test
 3 months
Motor coordination and balance1
Decreased
Description: Decreased muscle coordination
Exp Paradigm: Modified rota-rod test for motor performance and coordination through elimination of grips from rod
 Accelerating rotarod test
 5 months
Motor coordination and balance1
Decreased
Description: Small but significant impairment in muscle coordination
Exp Paradigm: Modified rota-rod test for motor performance and coordination through eliminatino of grips from rod
 Accelerating rotarod test
 5 months
Seizures1
Increased
Description: Spontaneous behavioral myoclonic jerks and seizures
Exp Paradigm: Electroencephalographic analysis (eeg) and video recordings
 Electroencephalogram (eeg)
 7 months
Seizures1
Increased
Description: Behavioral arrest followed by a series of repetitive, generalized myoclonic jerks coupled with high-amplitude bilateral cortical spikes and wave eeg discharge
Exp Paradigm: Electroencephalographic analysis (eeg) and video recordings
 Electroencephalogram (eeg)
 7 months
Social interaction1
Decreased
Description: Decreased sociability as measured by time spent in social side/area
Exp Paradigm: Sociability preference
 Three-chamber social approach test
 5.7 weeks
Social interaction1
Decreased
Description: Decreased social barrier interaction as measured by time active near stranger
Exp Paradigm: Barrier social interaction
 Partition test
 Unreported
Anxiety1
Increased
Description: Increased anxiety as reflected by lower exploration of center of open field
Exp Paradigm: Open field test
 Open field test
 Unreported
Anxiety1
Increased
Description: Increased anxiety
Exp Paradigm: Open field test
 Open field test
 Unreported
Anxiety1
Decreased
Description: Decreased anxiety indicated by more time spent in open arms
Exp Paradigm: Elevated plus maze test
 Elevated plus maze test
 4 weeks
Chromatin modification1
Abnormal
Description: Elevated levels in cerebellum, cerebral cortex, spleen with higher degree of alteration in cortex over cerebellum in the brain. unaltered in liver.
Exp Paradigm: Acetylation of histone h3
 Western blot
 Unreported
Chromatin modification1
Abnormal
Description: Abnormal acetylation of histone h3
Exp Paradigm: Acetylation of histone h3
 Western blot
 Unreported
Ultrasonic vocalization1
 No change
 Monitoring ultrasonic vocalizations
 P16
General characteristics1
 No change
 General observations
 6 weeks
General characteristics1
 No change
 General observations
 6 weeks
Cued or contextual fear conditioning1
 No change
 Fear conditioning test
 3, 5 months
Cued or contextual fear conditioning: memory of cue1
 No change
 Fear conditioning test
 3, 5 months
Spatial learning1
 No change
 Morris water maze test
 3, 5 months
Spatial learning1
 No change
 Morris water maze test
 3, 5 months
Spatial reference memory1
 No change
 Morris water maze test
 Unreported
Chromatin modification1
 No change
 Western blot
 Unreported
Chromatin modification1
 No change
 Western blot
 Unreported
Dna methylation1
 No change
 Dot-blot analysis
 Unreported
Gene expression1
 No change
 Quantitative pcr (qrt-pcr)
 Unreported
Protein expression level evidence1
 No change
 Laser scanning cytometry
 Unreported
Grip strength1
 No change
 Grip strength test
 Unreported
Grip strength1
 No change
 Grip strength test
 Unreported
Motor coordination and balance1
 No change
 Accelerating rotarod test
 3 months
Motor coordination and balance1
 No change
 Accelerating rotarod test
 3 months
Brain anatomy1
 No change
 Immunohistochemistry
 Unreported
Brain anatomy1
 No change
 Immunohistochemistry
 Unreported
Brain morphology1
 No change
 Histology
 Unreported
Brain morphology1
 No change
 Histology
 Unreported
Brain size1
 No change
 Pathology
 Unreported
Brain size1
 No change
 Pathology
 Unreported
Aggression1
 No change
 Resident-intruder test
 6 months
Aggression1
 No change
 Resident-intruder test
 6 months
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory

M_MECP2_4_KI_HT_TRUNC(308)

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity1
Decreased
Description: Decreased general locomotor activity
Exp Paradigm: Female mice: activity chamber monitoring
 Open field test
 Unreported
Dendritic architecture: spine density2
Decreased
Description: There is a decrease in the number of spines per 10 micro meter on distal dendrites in the mexp2 308 t mice
Exp Paradigm: Males only
 Sholl analysis
 2-4 months
Social interaction1
Decreased
Description: Decreased social barrier interaction as measured by time active near stranger
Exp Paradigm: Female mice: barrier social interaction
 Partition test
 Unreported
Eye blink conditioning2
Decreased
Description: Response amplitude is reduced in mecp2 308t mice, even though there is no deficit in learning conditioned response
Exp Paradigm: Males only
 Eyeblink conditioning
 2-4 months
Ultrasonic vocalization1
 No change
 Monitoring ultrasonic vocalizations
 P16
Size/growth1
 No change
 General observations
 P8-p18
Anxiety1
 No change
 Elevated plus maze test
 Unreported
Eye blink conditioning2
 No change
 Eyeblink conditioning
 2-4 months
Eye blink conditioning: extinction and reactivation2
 No change
 Eyeblink conditioning
 2-4 months
Spatial reference memory1
 No change
 Morris water maze test
 Unreported
Dna methylation1
 No change
 Dot-blot analysis
 Unreported
Gene expression1
 No change
 Quantitative pcr (qrt-pcr)
 Unreported
Protein expression level evidence1
 No change
 Laser scanning cytometry
 Unreported
Cerebellar morphology: granule cell layer thickness2
 No change
 Histology
 2-4 months
Cerebellar morphology: molecular layer thickness2
 No change
 Histology
 2-4 months
Dendritic architecture: dendritic tree complexity2
 No change
 Sholl analysis
 2-4 months
Neuronal number: purkinje cells2
 No change
 Histology
 2-4 months
Social interaction1
 No change
 Three-chamber social approach test
 Unreported
Social interaction1
 No change
 Three-chamber social approach test
 Unreported
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Emotion, Immune response, Maternal behavior, Molecular profile, Motor phenotype, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_26_OE_HE_NEURON-WB

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Motor coordination and balance1
Decreased
Description: Decreased motor coordination demonstrated by less time spent on the rotarod
Exp Paradigm: Rotarod test
 Accelerating rotarod test
 Unreported
Presynaptic function: paired-pulse facilitation1
Decreased
Description: Decreased paired pulse faciliation
Exp Paradigm: Response to two pulses separated by varying interstimulus intervals and taking the ratio
 Field potential recordings
 8-12 weeks
Synaptic plasticity1
Decreased
Description: Decreased synaptic plasticity demonstrated by attenuated hfs-induced ltp in hippocampal slices
Exp Paradigm: Fepsp recordings of hippocampal slices of the schaffer-collateral pathway using hfs
 Field potential recordings
 8-12 weeks
Size/growth1
Decreased
Description: Decreased body weight
Exp Paradigm: General observations
 General observations
 Unreported
Anxiety1
Increased
Description: Increased anxiety demonstrated by more time spent in dark side vs. light side
Exp Paradigm: Dark/light box test
 Light-dark exploration test
 Unreported
Anxiety1
Increased
Description: Increased anxiety demonstrated by less time spent in center, more time in closed arms, and less time in open arms
Exp Paradigm: Elevated plus maze test
 Elevated plus maze test
 Unreported
Object recognition memory1
Decreased
Description: Decreased novel object recognition memory demonstratedy by significantly less time spend with object
Exp Paradigm: Novel object recognition test
 Novel object recognition test
 Unreported
Cued or contextual fear conditioning1
Increased
Description: Increased cued conditioning anamolies demonstrated by increased freezing response in both context and cue fear conditioning
Exp Paradigm: Cued/contextual fear-conditioning paradigm
 Fear conditioning test
 Unreported
Cognitive flexibility: associative learning1
Decreased
Description: Decreased associative learning demonstrated by impaired extinction of freezing behavior to cue
Exp Paradigm: Cue conditioning training during extinction training
 Fear conditioning test
 Unreported
Protein expression level evidence1
Increased
Description: Increased expression of mecp2 protein in caudate-putamen, frontal cortex, hippocampus, and cerebellum
Exp Paradigm: Mecp2 protein expression
 Western blot
 Unreported
Protein expression level evidence1
Increased
Description: Increased mecp2 within specific subregions of hippocampus
Exp Paradigm: Mecp2 protein expression
 Immunohistochemistry
 Unreported
General locomotor activity1
 No change
 Home cage behavior
 Unreported
Synaptic transmission1
 No change
 Field potential recordings
 8-12 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_5.3_KO_HT

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity1
Decreased
Description: Decreased locomotor activity indicated by less distance traveled and reduced horizontal and vertical activity
Exp Paradigm: Open field test
 Open field test
 4 months
Motor coordination and balance1
Decreased
Description: Decreased motoro coordination indicated by greater number of footslips
Exp Paradigm: Grid walking test
 Footslip test
 4 months
Pain or nociception1
Decreased
Description: Decreased pain sensitivity to conductive heat stimulus indicated by increase in latency to respond when placed on a heted metal surface
Exp Paradigm: Female mice: hot plate test
 Hot plate test
 5 months
Startle response: acoustic stimulus1
Decreased
Description: Decreased startle response: acoustic stimulus response to 70-102 db, 102 to 118 db, and max 120 db audio stimulus
Exp Paradigm: Sensorimotor gating response to series of sounds from 70 to 118 db
 Startle response test
 7, 20 weeks
Sensorimotor gating1
Increased
Description: Increased prepulse inhibition (ppi) of the startle response: acoustic stimulus
Exp Paradigm: Prepulse inhibition of sensorimotor gating
 Prepulse inhibition
 7, 20 weeks
Social approach1
Decreased
Description: Decreased social approach indicated by less time spent investigating novel mouse
Exp Paradigm: Three chambered assay for sociability
 Three-chamber social approach test
 5 months
Respiratory function1
Abnormal
Description: Abnormal respiratory function indicative of breathing abnormalities through number of apneas per 1000 breaths
Exp Paradigm: Number of apneas and respiratory rate
 Respiration rate and pattern analysis
 7 weeks
Size/growth1
Increased
Description: Increased body weight
Exp Paradigm: General observations
 General observations
 8-22 weeks
Anxiety1
Decreased
Description: Decreased anxiety indicated by more time spent in lit compartment
Exp Paradigm: Light/dark box assay
 Light-dark exploration test
 5 weeks
Anxiety1
Decreased
Description: Decreased anxiety indicated by more time in open arms along with more open arm entries and more distance traveled
Exp Paradigm: Elevated plus maze test
 Elevated plus maze test
 5 weeks
Cued or contextual fear conditioning: passive avoidance1
Decreased
Description: Decreased passive avoidance learning indicated by decreased latency to enter dark compartment and fewer animals associating shock with dark compartment
Exp Paradigm: Passive avoidance task
 Passive avoidance test
 14 weeks
Cued or contextual fear conditioning: memory of context1
Decreased
Description: Decreased contextual fear memory but normal cued fear memory
Exp Paradigm: Pavlovian fear conditioning
 Fear conditioning test
 14 weeks
Protein expression level evidence1
Decreased
Description: Decreased expression of mecp2 in hypothalamus to 40 to 85% levels
Exp Paradigm: Mecp2 levels
 Quantitative pcr (qrt-pcr)
 5 months
General locomotor activity1
 No change
 Open field test
 7 weeks
Olfaction1
 No change
 Olfactory discrimination test
 12 weeks
Social approach1
 No change
 Three-chamber social approach test
 12 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure

M_MECP2_5.4_KO_HT

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity1
Decreased
Description: Decreased locomotor activity indicated by less distance traveled and reduced horizontal and vertical activity
Exp Paradigm: Open field test
 Open field test
 4 months
Motor coordination and balance1
Decreased
Description: Decreased motoro coordination indicated by greater number of footslips
Exp Paradigm: Grid walking test
 Footslip test
 Unreported
Startle response: acoustic stimulus1
Decreased
Description: Decreased startle response: acoustic stimulus response to 102-118 db & max 120 db audio stimulus
Exp Paradigm: Sensorimotor gating response to series of sounds from 70 to 118 db
 Startle response test
 5 months
Pain or nociception1
Decreased
Description: Decreased pain sensitivity to conductive heat stimulus indicated by increase in latency to respond when placed on a heted metal surface
Exp Paradigm: Female mice: hot plate test
 Hot plate test
 5.5 months
Social approach1
Decreased
Description: Decreased social approach indicated by less time spent investigating novel mouse and novel object
Exp Paradigm: Three chambered assay for sociability
 Three-chamber social approach test
 5.5 months
Social approach1
Decreased
Description: Decreased social approach indicated by equal amount of time investigating either a novel mouse or a novel object
Exp Paradigm: Three chambered assay for sociability
 Three-chamber social approach test
 12 weeks
Respiratory function1
Abnormal
Description: Abnormal respiratory function indicative of breathing abnormalities through number of apneas per 1000 breaths
Exp Paradigm: Number of apneas and respiratory rate
 Respiration rate and pattern analysis
 7 weeks
Hormone levels1
Decreased
Description: Decreased expression of sst in hypothalamus
Exp Paradigm: Qrt-pcr analysis
 Quantitative pcr (qrt-pcr)
 5.5 months
Size/growth1
Increased
Description: Increased body weight
Exp Paradigm: General observations
 General observations
 12 months
Anxiety1
Decreased
Description: Decreased anxiety indicated by more time spent in lit compartment along with more transitions to lit compartment
Exp Paradigm: Light/dark box assay
 Light-dark exploration test
 5 weeks
Anxiety1
Decreased
Description: Decreased anxiety indicated by more time in open arms along with more open arm entries and more distance traveled
Exp Paradigm: Elevated plus maze test
 Elevated plus maze test
 5 weeks
Cued or contextual fear conditioning: passive avoidance1
Decreased
Description: Decreased passive avoidance learning indicated by decreased latency to enter dark compartment and fewer animals associating shock with dark compartment
Exp Paradigm: Passive avoidance task
 Passive avoidance test
 14 weeks
Cued or contextual fear conditioning: memory of context1
Decreased
Description: Decreased contextual fear memory but normal cued fear memory
Exp Paradigm: Pavlovian fear conditioning
 Fear conditioning test
 14 weeks
Protein expression level evidence1
Decreased
Description: Decreased expression of mecp2 in hypothalamus to 55 to 85% levels
Exp Paradigm: Mecp2 levels
 Quantitative pcr (qrt-pcr)
 5.5 months
Size/growth1
 No change
 General observations
 8-22 weeks
General locomotor activity1
 No change
 Open field test
 7 weeks
Olfaction1
 No change
 Olfactory discrimination test
 12 weeks
Sensorimotor gating1
 No change
 Prepulse inhibition
 7, 20 weeks
Startle response: acoustic stimulus1
 No change
 Startle response test
 7 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure

M_MECP2_1.3_KO_HT

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Motor coordination and balance1
Decreased
Description: Decreased motor coordination demonstrated by shorter latency to fall
Exp Paradigm: Female mice: rotorod test
 Accelerating rotarod test
 6 weeks
Size/growth1
 No change
 General observations
 6.5 weeks
Cued or contextual fear conditioning1
 No change
 Fear conditioning test
 6 weeks
General locomotor activity1
 No change
 Light-dark exploration test
 Unreported
Grip strength1
 No change
 Grip strength test
 6.5 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Maternal behavior, Molecular profile, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_5.5_CKO_HE_PVALBN

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Motor coordination and balance1
Decreased
Description: Mecp2 pvn ko mice have reduced motor coordination and balance as the latency to fall from the accelerating rotarod and dowel walk assay, authors also attribute reduced marble burying to reduced coordination in forelimbs
Exp Paradigm: Dowel walk test
 Dowel walk test
 6 weeks, 5 months, 2.5 months
Clasping reflex1
Increased
Description: Mecp2- pvn ko mice develop clear hind limb retraction (clasping) after 15 weeks of age
Exp Paradigm: NA
 General observations
 5 months
Ataxia1
Increased
Description: Mecp2-pvn ko mice have increased ataxia measured as shorter latency to fall of the accelerating rotarod and in the dowel walk test, the ataxia worsens with age and by 10 weeks the mutants also have splayed hindlegs determined by footprint analysis
Exp Paradigm: Dowel walk test
 Dowel walk test
 6 weeks, 5 months, 2.5 months
Motor coordination and balance1
Decreased
Description: Mecp2 pvn ko mice have reduced motor coordination and balance as the latency to fall from the accelerating rotarod and dowel walk assay, authors also attribute reduced marble burying to reduced coordination in forelimbs
Exp Paradigm: Marble-burying test
 Marble-burying test
 6 weeks, 5 months, 2.5 months
Ataxia1
Increased
Description: Mecp2-pvn ko mice have increased ataxia measured as shorter latency to fall of the accelerating rotarod and in the dowel walk test, the ataxia worsens with age and by 10 weeks the mutants also have splayed hindlegs determined by footprint analysis
Exp Paradigm: Accelerating rotarod test
 Accelerating rotarod test
 6 weeks, 5 months, 2.5 months
Repetitive digging1
Decreased
Description: Mecp2-pvn ko mice have decreased number of marbles buried in the marble burying task, authors attribute that to reduced coordination in the forelimbs
Exp Paradigm: NA
 Marble-burying test
 5.2 months
Startle response: acoustic stimulus1
Decreased
Description: Mecp2-pvn ko mice have decreased response to startle response: acoustic stimulus
Exp Paradigm: NA
 Startle response test
 8 weeks
Social interaction1
Abnormal
Description: In the partition test mecp2-pvn ko mice show increased interaction with stranger conspecific mouse in the second phase, after habituation with a familiar mouse and prior to reintroduction of the familiar mouse
Exp Paradigm: The test is conducted in three phases: first is interaction with a familiar mouse housed in on the other side of a partition in home cage, second is interaction with a novel conspecific, age-matched mouse, third is reintroduction of the first familiar mouse
 Partition test
 3.5 months
Mortality/lethality1
Increased
Description: Mecp2- pvn ko mice have increased mortality and do not survive beyond 29 - 30 weeks of age
Exp Paradigm: NA
 General observations
 7.5 months
Cued or contextual fear conditioning: memory of cue1
Decreased
Description: Mecp2-pvn ko mice have significantly reduced memory of cue, assessed by differences in freezing response, in the fear conditioning paradigm compared to control floxed mecp2 mice that is significant at 15 weeks of age
Exp Paradigm: NA
 Fear conditioning test
 3.7 months
Targeted expression1
Decreased
Description: Mecp2 protein is ablated in the parvalbumin (pv) expressing interneurons
Exp Paradigm: NA
 Immunofluorescence staining
 NA
Size/growth1
 No change
 Body weight measurement
 1-6 months
Anxiety1
 No change
 Elevated plus maze test
 5 weeks
Anxiety1
 No change
 Light-dark exploration test
 5 weeks
General locomotor activity1
 No change
 Open field test
 4.75 months
Repetitive nose pokes1
 No change
 Hole-board test
 3 months
Seizures1
 No change
 Observation of seizures
 3.7 - 10 months
Sensorimotor gating1
 No change
 Prepulse inhibition
 8 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters

M_MECP2_5.6_CKO_HE_SSTN

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Clasping reflex1
Increased
Description: Mecp2- pvn ko mice develop clear hind limb retraction (clasping) after 15 weeks of age
Exp Paradigm: NA
 General observations
 5 months
Repetitive nose pokes1
Increased
Description: Mecp2- somn ko show increased repetitive behavior in the hole board test assessed by the number of nose pokes
Exp Paradigm: NA
 Hole-board test
 3 months
Seizures1
Increased
Description: Mecp2- somn ko have increased epileptic seizures and tonic cloni seizures while handling, about 50% of them develop seizures starting at 12 weeks of age
Exp Paradigm: NA
 Observation of seizures
 3 - 10 months
Mortality/lethality1
Increased
Description: Mecp2- somn ko mice have increased mortality and do not survive beyond 29 - 30 weeks of age
Exp Paradigm: NA
 Fear conditioning test
 7.5 months
Targeted expression1
Decreased
Description: Mecp2 protein is ablated in the somatostatin (som) expressing interneurons
Exp Paradigm: NA
 Western blot
 6 weeks, 5 months, 2.5 months
Size/growth1
 No change
 Body weight measurement
 1-6 months
Anxiety1
 No change
 Elevated plus maze test
 5 weeks
Anxiety1
 No change
 Light-dark exploration test
 5 weeks
Cued or contextual fear conditioning: memory of cue1
 No change
 Fear conditioning test
 3.7 months
Ataxia1
 No change
 General observations
 6 weeks, 5 months, 2.5 months
General locomotor activity1
 No change
 Open field test
 4.75 months
Motor coordination and balance1
 No change
 Accelerating rotarod test
 6 weeks, 5 months, 2.5 months
Repetitive digging1
 No change
 Marble-burying test
 3 - 5 months
Sensorimotor gating1
 No change
 Prepulse inhibition
 8 weeks
Startle response: acoustic stimulus1
 No change
 Startle response test
 8 weeks
Social interaction1
 No change
 Partition test
 3.5 months
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters

M_MECP2_39_KI_HE_R306C

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity1
Decreased
Description: Mecp2 r306 mutants have reduced distance traveled in the open field
Exp Paradigm: NA
 Open field test
 6-8 weeks
Sensorimotor gating1
Decreased
Description: Mecp2 r306 mutants have enhanced response to startle when the prepulse is acoustic as well
Exp Paradigm: NA
 Prepulse inhibition
 6-8 weeks
Tactile memory1
Decreased
Description: Mecp2 r306 mutants have reduced memory for discriminating objects that differ only in texture
Exp Paradigm: NA
 Textured novel object recognition test (t-nort)
 6-8 weeks
Startle response: acoustic stimulus1
Decreased
Description: Mecp2 r306 mutants have reduced startle reflex to 125 db noise
Exp Paradigm: NA
 Startle response test
 6-8 weeks
Sensorimotor gating: tactile cue1
Decreased
Description: Mecp2 r306 mutants have enhanced response to startle when the prepulse is a tactile cue (airpuff) unlike controls
Exp Paradigm: NA
 Prepulse inhibition
 6-8 weeks
Touch1
Increased
Description: Mecp2 r306 mutants are hypersensitive or have increased response to air puff
Exp Paradigm: NA
 Response to air puff
 6-8 weeks
Social dominance1
Decreased
Description: Mecp2 r306 mutants exhibit decreased dominance and aggression and lose majority of matches compared to controls
Exp Paradigm: NA
 Tube test of social dominance
 6-8 weeks
Nest building behavior1
Decreased
Description: Mecp2 r306 mutants have reduced nest building skills
Exp Paradigm: NA
 Nest building assay
 6-8 weeks
Mortality/lethality1
Increased
Description: Mecp2 r306 mutants have reduced survival rates (observed upto 40 weeks)
Exp Paradigm: NA
 Survival analysis
 1-10 months
Anxiety1
Increased
Description: Mecp2 r306 mutants have reduced time spent in the center of of and reduced preference for the open arms in the elevated plus maze test indicating increased anxiety
Exp Paradigm: Open field test
 Open field test
 6-8 weeks
Anxiety1
Increased
Description: Mecp2 r306 mutants have reduced time spent in the center of of and reduced preference for the open arms in the elevated plus maze test indicating increased anxiety
Exp Paradigm: Elevated plus maze test
 Elevated plus maze test
 6-8 weeks
Habituation to aversive stimuli1
Decreased
Description: Mecp2 r306 mutants have reduced habituation to aversive acoustic stimuli unlike controls
Exp Paradigm: NA
 Startle response test
 6-8 weeks
Object recognition memory: long-term recall1
Decreased
Description: Mecp2 r306 mutants have decreased recall of familiar objects when the novel object phase is conducted after a longer interval (1 hr)
Exp Paradigm: NA
 Novel object recognition test
 6-8 weeks
Exploratory activity1
 No change
 Textured novel object recognition test (t-nort)
 6-8 weeks
Object recognition memory1
 No change
 Novel object recognition test
 6-8 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Maternal behavior, Molecular profile, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure

M_MECP2_40_KI_HE_STOP

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Motor coordination and balance1
Decreased
Description: Mecp2 stop mice have reduced latency to fall off compared to controls in the accelerating rotarod
Exp Paradigm: NA
 Accelerating rotarod test
 6-8 weeks
Synaptic neuroreceptors1
Decreased
Description: Mecp2 stop mouse spinal cords have reduced expression of gabrb3 in presynaptic puncta that are vglut +ve, observed in the spinal cord dorsal horn lamina iii
Exp Paradigm: NA
 Immunohistochemistry
 3-6 months
Brain size1
Decreased
Description: Mecp2 stop mice have decreased brain size compared to controls
Exp Paradigm: NA
 Histology
 3-6 months
Dorsal root potential (drp)1
Decreased
Description: Dorsal root potential (drp) (peak) amplitude is significantly less than controls in mecp2 stop mice indicating reduced gabaa mediated presynaptic inhibition of somatosensory input into the dorsal horn (which may cause hyperexcitability due to lack of reduction of response mediated by cns to repeated tactile stimulation)
Exp Paradigm: NA
 Whole-cell patch clamp
 P14-p19
Sensorimotor gating: tactile cue1
Decreased
Description: Mecp2 stop mice have impaired sensorimotor gating as they exhibit enhanced response to tactile prepulse (air puff)
Exp Paradigm: NA
 Prepulse inhibition
 6-8 weeks
Touch1
Increased
Description: Mecp2 stop mice have increased sensitivity to touch on hair skin by air puff
Exp Paradigm: NA
 Response to air puff
 6-8 weeks
Sensorimotor gating1
Decreased
Description: Mecp2 stop mice have impaired sensorimotor gating when the prepulse is acoustic as well
Exp Paradigm: NA
 Prepulse inhibition
 6-8 weeks
Tactile memory1
Decreased
Description: Mecp2 stop mice have reduced tactile discrimination (glabrous skin) and memory for objects differing in texture (rough or smooth) and do not preferentially interact with a novel textured-object over a familiar one
Exp Paradigm: NA
 Textured novel object recognition test (t-nort)
 6-8 weeks
Startle response: acoustic stimulus1
Decreased
Description: Similar to other mecp2 null mice, mecp2 stop mice also have reduced response to acoustic startle at 125 db
Exp Paradigm: NA
 Startle response test
 6-8 weeks
Nest building behavior1
Decreased
Description: Mecp2 stop mice have reduced nest building material broken down than controls
Exp Paradigm: NA
 Nest building assay
 6-8 weeks
Social memory1
Decreased
Description: Mecp2 stop mice have reduced preference for a stranger mouse over familiar mouse
Exp Paradigm: NA
 Three-chamber social approach test
 6-8 weeks
Social dominance1
Decreased
Description: Mecp2 stop mice have reduced dominant or aggressive behavior as in the tube test of dominance they have significantly fewer wins compared to controls
Exp Paradigm: NA
 Tube test of social dominance
 6-8 weeks
Social approach1
Decreased
Description: Mecp2 stop mice have reduced preference for a stranger mouse over empty cage
Exp Paradigm: NA
 Three-chamber social approach test
 6-8 weeks
Habituation to aversive stimuli1
Decreased
Description: Mecp2 stop mice have reduced habituation to aversive startle noise compared to controls
Exp Paradigm: NA
 Startle response test
 6-8 weeks
Anxiety1
Increased
Description: Mecp2 stop mice show increased anxiety- like behavior in the open field (time spent in center) and elevated plus maze test (preference for open arms)
Exp Paradigm: Open field test
 Open field test
 6-8 weeks
Anxiety1
Increased
Description: Mecp2 stop mice show increased anxiety- like behavior in the open field (time spent in center) and elevated plus maze test (preference for open arms)
Exp Paradigm: Elevated plus maze test
 Elevated plus maze test
 6-8 weeks
Object recognition memory: long-term recall1
Decreased
Description: Mecp2 stop mice have reduced long term recall of familiar objects
Exp Paradigm: NA
 Novel object recognition test
 6-8 weeks
Exploratory activity1
 No change
 Textured novel object recognition test (t-nort)
 6-8 weeks
Object recognition memory1
 No change
 Novel object recognition test
 6-8 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Maternal behavior, Molecular profile, Physiological parameters, Repetitive behavior, Seizure

M_MECP2_5.11_CKO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Motor coordination and balance1
Decreased
Description: Emx1- mecp2 cko mice have reduced latency to fall off an accelerating rotarod
Exp Paradigm: NA
 Accelerating rotarod test
 6-8 weeks
General locomotor activity1
Decreased
Description: Emx1-mecp2 cko mice have reduced distance traveled in the open field test
Exp Paradigm: NA
 Open field test
 6-8 weeks
Startle response: acoustic stimulus1
Decreased
Description: Emx1-mecp2 cko mice have normal startle response to 125 db noise
Exp Paradigm: NA
 Startle response test
 6-8 weeks
Mortality/lethality1
 No change
 Survival analysis
 1-10 months
Anxiety1
 No change
 Elevated plus maze test
 6-8 weeks
Anxiety1
 No change
 Open field test
 6-8 weeks
Exploratory activity1
 No change
 Textured novel object recognition test (t-nort)
 6-8 weeks
Habituation to aversive stimuli1
 No change
 Startle response test
 6-8 weeks
Object recognition memory1
 No change
 Novel object recognition test
 6-8 weeks
Object recognition memory: long-term recall1
 No change
 Novel object recognition test
 6-8 weeks
Sensorimotor gating1
 No change
 Prepulse inhibition
 6-8 weeks
Sensorimotor gating: tactile cue1
 No change
 Prepulse inhibition
 6-8 weeks
Tactile memory1
 No change
 Textured novel object recognition test (t-nort)
 6-8 weeks
Touch1
 No change
 Response to air puff
 6-8 weeks
Nest building behavior1
 No change
 Nest building assay
 6-8 weeks
Social approach1
 No change
 Three-chamber social approach test
 6-8 weeks
Social dominance1
 No change
 Tube test of social dominance
 6-8 weeks
Social memory1
 No change
 Three-chamber social approach test
 6-8 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Maternal behavior, Molecular profile, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure

M_MECP2_5.13_CKO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Touch1
Increased
Description: Mice with loss of mecp2 from primary somatosensory neurons in adulthood have increased sensitivity to air puff alone
Exp Paradigm: NA
 Response to air puff
 6-8 weeks
Tactile memory1
Decreased
Description: Mice with loss of mecp2 from primary somatosensory neurons in adulthood still leads to decreased glabrous skin tactile discrimination of objects differing only in texture
Exp Paradigm: NA
 Textured novel object recognition test (t-nort)
 6-8 weeks
Sensorimotor gating: tactile cue1
Decreased
Description: Mice with loss of mecp2 from primary somatosensory neurons in adulthood have decreased sensorimotor gating in prepulse inhibition with hairy skin tactile prepulse
Exp Paradigm: NA
 Prepulse inhibition
 6-8 weeks
Social memory1
Decreased
Description: Mice with loss of mecp2 from primary somatosensory neurons in adulthood have decreased preference for novel mouse over familiar mouse
Exp Paradigm: NA
 Three-chamber social approach test
 6-8 weeks
Social dominance1
Increased
Description: Mice with loss of mecp2 from primary somatosensory neurons in adulthood have increased number of wins compared to controls (and embryonic avl-cre mecp2 mice) in the tube test of dominance
Exp Paradigm: NA
 Tube test of social dominance
 6-8 weeks
Nest building behavior1
Decreased
Description: Mice with loss of mecp2 from primary somatosensory neurons in adulthood have reduced nest building ability
Exp Paradigm: NA
 Nest building assay
 6-8 weeks
Mortality/lethality1
 No change
 Survival analysis
 1-10 months
Anxiety1
 No change
 Elevated plus maze test
 6-8 weeks
Anxiety1
 No change
 Open field test
 6-8 weeks
Exploratory activity1
 No change
 Textured novel object recognition test (t-nort)
 6-8 weeks
Habituation to aversive stimuli1
 No change
 Startle response test
 6-8 weeks
Object recognition memory: long-term recall1
 No change
 Novel object recognition test
 6-8 weeks
General locomotor activity1
 No change
 Open field test
 6-8 weeks
Motor coordination and balance1
 No change
 Accelerating rotarod test
 6-8 weeks
Sensorimotor gating1
 No change
 Prepulse inhibition
 6-8 weeks
Startle response: acoustic stimulus1
 No change
 Startle response test
 6-8 weeks
Social approach1
 No change
 Three-chamber social approach test
 6-8 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Maternal behavior, Molecular profile, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure

M_MECP2_5.13_CKO_HT

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Touch1
Increased
Description: Mice with loss of mecp2 from primary somatosensory neurons in adulthood have increased sensitivity to air puff alone
Exp Paradigm: NA
 Response to air puff
 6-8 weeks
Tactile memory1
Decreased
Description: Mice with loss of mecp2 from primary somatosensory neurons in adulthood still leads to decreased glabrous skin tactile discrimination of objects differing only in texture
Exp Paradigm: NA
 Textured novel object recognition test (t-nort)
 6-8 weeks
Sensorimotor gating: tactile cue1
Decreased
Description: Mice with loss of mecp2 from primary somatosensory neurons in adulthood have decreased sensorimotor gating in prepulse inhibition with hairy skin tactile prepulse
Exp Paradigm: NA
 Prepulse inhibition
 6-8 weeks
Exploratory activity1
 No change
 Textured novel object recognition test (t-nort)
 6-8 weeks
Object recognition memory: long-term recall1
 No change
 Novel object recognition test
 6-8 weeks
Sensorimotor gating1
 No change
 Prepulse inhibition
 6-8 weeks
Startle response: acoustic stimulus1
 No change
 Startle response test
 6-8 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Maternal behavior, Molecular profile, Motor phenotype, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Social behavior

M_MECP2_5.14_CKO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Motor coordination and balance1
Decreased
Description: Cdx-mecp2 cko have reduced balance and coordination and fall off the accelerating rotarod at a shorter latency compared to controls
Exp Paradigm: NA
 Accelerating rotarod test
 6-8 weeks
Tactile memory1
Decreased
Description: Cdx-mecp2 cko have decreased glabrous skin tactile discrimination and cannot differentiate between novel or familiar object differing in texture
Exp Paradigm: NA
 Textured novel object recognition test (t-nort)
 6-8 weeks
Startle response: acoustic stimulus1
Decreased
Description: Cdx-mecp2 cko have decreased response to acoustic startle compared to controls at 125 db noise level
Exp Paradigm: NA
 Startle response test
 6-8 weeks
Sensorimotor gating: tactile cue1
Decreased
Description: Cdx-mecp2 cko have decreased sensorimotor gating resulting in enhanced response in hairy skin tactile cue based prepulse inhibition compared to controls
Exp Paradigm: NA
 Prepulse inhibition
 6-8 weeks
Touch1
Increased
Description: Cdx-mecp2 cko have increased sensitivity towards touch or air puff on hairy skin
Exp Paradigm: NA
 Response to air puff
 6-8 weeks
Respiratory function1
Decreased
Description: Cdx-mecp2 cko mice have impaired respiratory tidal volume, expiration and breathing rate
Exp Paradigm: NA
 Whole body plethysmography
 2-2.5 months
Size/growth1
Decreased
Description: Cdx-mecp2 cko mice have reduced body weight compared to controls
Exp Paradigm: NA
 Body weight measurement
 2-2.5 months
Mortality/lethality1
Increased
Description: Cdx-mecp2 cko mice have increased mortality at about 50% by 16 weeks
Exp Paradigm: NA
 Survival analysis
 1-10 months
Object recognition memory1
 No change
 Novel object recognition test
 6-8 weeks
Object recognition memory: long-term recall1
 No change
 Novel object recognition test
 6-8 weeks
Brain size1
 No change
 Histology
 3-6 months
Sensorimotor gating1
 No change
 Prepulse inhibition
 6-8 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Maternal behavior, Molecular profile, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Social behavior

M_MECP2_5.15_CKO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity1
Decreased
Description: Avl-cre mecp2 have reduced general locomotor activity in open field
Exp Paradigm: NA
 Open field test
 6-8 weeks
Synaptic neuroreceptors1
Decreased
Description: Avl-cre mecp2 spinal cords have reduced expression of gabrb3 in presynaptic puncta that are vglut +ve, observed in the spinal cord dorsal horn lamina iii
Exp Paradigm: Males only
 Immunohistochemistry
 3-6 months
Neurotransmitter release: quantal parameters1
Increased
Description: Avl-cre mecp2 mechanosensory afferents that synapse to postsynaptic dorsal column projection neurons may have enhanced probability of presynaptic release of neurotransmitter, indirectly measured using quantal epsc frequency and decay times of currents
Exp Paradigm: NA
 Whole-cell patch clamp
 6-8 weeks
Dorsal root potential (drp)1
Decreased
Description: Avl-cre mecp2 have decreased dorsal root potential indicating decrease in activity dependent presynaptic inhibition (psi) in the dorsal root, authors indicate that loss of mecp2 from primary somatosensory neurons causes deficiency of gabaa receptors on somatosensory neurons terminals that are known to mediate psi (and psi is decreased) this in turn causes increase in sensitivity to light touch
Exp Paradigm: NA
 Whole-cell patch clamp
 P14-p19
Quantal post synaptic current frequency: excitatory1
Increased
Description: Psdcs have increased frequency of evoked qepscs in avl-cre mecp2 mice indicating changes in presynaptic release probability
Exp Paradigm: NA
 Whole-cell patch clamp
 P14-p19
Tactile memory1
Decreased
Description: Avl-cre mecp2 have decreased glabrous skin tactile discrimination and cannot differentiate between novel or familiar object differing in texture
Exp Paradigm: NA
 Textured novel object recognition test (t-nort)
 6-8 weeks
Sensorimotor gating: tactile cue1
Decreased
Description: Avl-cre mecp2 decreased sensorimotor gating resulting in enhanced response in hairy skin tactile cue based prepulse inhibition compared to controls
Exp Paradigm: NA
 Prepulse inhibition
 6-8 weeks
Touch1
Increased
Description: Avl-cre mecp2 have increased sensitivity towards touch or air puff on hairy skin
Exp Paradigm: NA
 Response to air puff
 6-8 weeks
Social dominance1
Decreased
Description: Avl-cre mecp2 have significantly reduced wins compared to controls in tube test of dominance
Exp Paradigm: Males only
 Tube test of social dominance
 6-8 weeks
Social approach1
Decreased
Description: Avl-cre mecp2 have decreased preference for stranger mouse over object compared to controls
Exp Paradigm: Males only
 Three-chamber social approach test
 6-8 weeks
Nest building behavior1
Decreased
Description: Avl-cre mecp2 have reduced nest building ability as more nest building material is left intact
Exp Paradigm: Males only
 Nest building assay
 6-8 weeks
Social memory1
Decreased
Description: Avl-cre mecp2 have decreased preference for novel mouse over familiar mouse compared to controls
Exp Paradigm: Males only
 Three-chamber social approach test
 6-8 weeks
Habituation to aversive stimuli1
Decreased
Description: Avl-cre mecp2 have reduced habituation to aversive acoustic stimulus
Exp Paradigm: Males only
 Startle response test
 6-8 weeks
Anxiety1
Increased
Description: Avl-cre mecp2 have reduced time spent in the center of the open field and reduced preference for open arms compared to controls indicating increase in anxiety
Exp Paradigm: Open field test
 Open field test
 6-8 weeks
Anxiety1
Increased
Description: Avl-cre mecp2 have reduced time spent in the center of the open field and reduced preference for open arms compared to controls indicating increase in anxiety
Exp Paradigm: Elevated plus maze test
 Elevated plus maze test
 6-8 weeks
Mortality/lethality1
 No change
 Survival analysis
 1-10 months
Size/growth1
 No change
 Body weight measurement
 2-2.5 months
Exploratory activity1
 No change
 Textured novel object recognition test (t-nort)
 6-8 weeks
Object recognition memory1
 No change
 Novel object recognition test
 6-8 weeks
Motor coordination and balance1
 No change
 Accelerating rotarod test
 6-8 weeks
Brain size1
 No change
 Histology
 3-6 months
Decay kinetics of evoked post synaptic currents1
 No change
 Whole-cell patch clamp
 P14-p19
Quantal post synaptic current amplitude: excitatory1
 No change
 Whole-cell patch clamp
 P14-p19
Spinal reflex: ventral root potential (vrp)1
 No change
 Whole-cell patch clamp
 P14-p19
Respiratory function1
 No change
 Whole body plethysmography
 2-2.5 months
Sensorimotor gating1
 No change
 Prepulse inhibition
 6-8 weeks
Startle response: acoustic stimulus1
 No change
 Startle response test
 6-8 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Maternal behavior, Molecular profile, Physiological parameters, Repetitive behavior, Seizure

M_MECP2_5.15_CKO_HT

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Touch1
Increased
Description: Avl-cre mecp2 have increased sensitivity towards touch or air puff on hairy skin
Exp Paradigm: NA
 Response to air puff
 6-8 weeks
Tactile memory1
Decreased
Description: Avl-cre mecp2 have decreased glabrous skin tactile discrimination and cannot differentiate between novel or familiar object differing in texture
Exp Paradigm: NA
 Textured novel object recognition test (t-nort)
 6-8 weeks
Exploratory activity1
 No change
 Textured novel object recognition test (t-nort)
 6-8 weeks
Object recognition memory1
 No change
 Novel object recognition test
 6-8 weeks
Sensorimotor gating1
 No change
 Prepulse inhibition
 6-8 weeks
Startle response: acoustic stimulus1
 No change
 Startle response test
 6-8 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Maternal behavior, Molecular profile, Motor phenotype, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Social behavior

M_MECP2_46_KI_HE_TRUNC(N-TERM)

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Mortality/lethality1
 No change
 General observations
 0-52 weeks
Size/growth1
 No change
 Body weight measurement
 4-52 weeks
Anxiety1
 No change
 Elevated plus maze test
 20 weeks
Anxiety1
 No change
 Open field test
 20 weeks
Targeted expression1
 No change
 Western blot
 6-13 weeks
General locomotor activity: ambulatory activity1
 No change
 Open field test
 20 weeks
Motor coordination and balance1
 No change
 Accelerating rotarod test
 20 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Learning & memory, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_47_KI_HE_TRUNC(N-C-TERM)

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Size/growth1
Increased
Description: Mecp2-dnc mutant mice showed slight increase in growth compared to controls.
Exp Paradigm: NA
 Body weight measurement
 4-52 weeks
Anxiety1
Decreased
Description: Mecp2-dnc mutant mice showed an increase in time spent in the central region of the open field test compared to controls.
Exp Paradigm: NA
 Open field test
 20 weeks
Targeted expression1
Increased
Description: Mecp2-dnc mutant mice showed increased expression of the truncated proteins in the brain and in neurons compared to controls.
Exp Paradigm: NA
 Western blot
 6-13 weeks
Mortality/lethality1
 No change
 General observations
 0-52 weeks
Anxiety1
 No change
 Elevated plus maze test
 20 weeks
General locomotor activity: ambulatory activity1
 No change
 Open field test
 20 weeks
Motor coordination and balance1
 No change
 Accelerating rotarod test
 20 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Learning & memory, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_48_KI_HE_TRUNC(N-I-C)

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Motor coordination and balance1
Decreased
Description: Mecp2-dnic mutant mice showed a decrease in latency to fall from the accelerating rotarod compared to controls.
Exp Paradigm: NA
 Accelerating rotarod test
 20 weeks
Limb posture1
Abnormal
Description: Mecp2-dnic mutant mice showed partial hindlimb clasping behavior compared to controls.
Exp Paradigm: NA
 General observations
 4-52 weeks
Gait1
Abnormal
Description: Mecp2-dnic mutant mice showed gait abnormalities compared to controls.
Exp Paradigm: NA
 General observations
 4-52 weeks
Size/growth1
Decreased
Description: Mecp2-dnic mutant mice showed significant decrease in growth compared to controls.
Exp Paradigm: NA
 Body weight measurement
 4-52 weeks
Anxiety1
Decreased
Description: Mecp2-dnic mutant mice spent less time in the closed arms and more time in the center of the elevated plus maze compared to controls. however, mecp2-dnic mutant mice showed no difference in time spent in the open arms of the elevated plus maze compared to controls.
Exp Paradigm: NA
 Elevated plus maze test
 20 weeks
Targeted expression1
Decreased
Description: Mecp2-dnic mutant mice showed a reduction in expression levels of the truncated protein in the brain (~50%) and in neurons (~40%) compared to controls.
Exp Paradigm: NA
 Western blot
 6-13 weeks
Mortality/lethality1
 No change
 General observations
 0-52 weeks
Anxiety1
 No change
 Open field test
 20 weeks
Targeted expression1
 No change
 Quantitative pcr (qrt-pcr)
 11 weeks
General locomotor activity: ambulatory activity1
 No change
 Open field test
 20 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Learning & memory, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_49_KI_HE_R133C

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Gait1
Abnormal
Description: Knockin r133c mutant mice showed an increase in phenotypic severity scores compared to wt controls.
Exp Paradigm: NA
 General observations
 4-28 weeks
Tremor1
Abnormal
Description: Knockin r133c mutant mice showed an increase in phenotypic severity scores compared to wt controls.
Exp Paradigm: NA
 General observations
 4-28 weeks
Limb posture1
Abnormal
Description: Knockin r133c mutant mice showed an increase in phenotypic severity scores compared to wt controls.
Exp Paradigm: NA
 General observations
 4-28 weeks
General locomotor activity1
Abnormal
Description: Knockin r133c mutant mice showed an increase in phenotypic severity scores compared to wt controls.
Exp Paradigm: NA
 General observations
 4-28 weeks
Size/growth1
Decreased
Description: Knockin r133c mutant mice showed significant decrease in growth compared to controls.
Exp Paradigm: NA
 Body weight measurement
 4-52 weeks
Mortality/lethality1
Increased
Description: Mecp2 knockin r133c mutant mice showed an increase in mortality compared to wt controls.
Exp Paradigm: NA
 General observations
 0-30 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_50_KI_HE_STOP

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Gait1
Abnormal
Description: Mecp2-dnic-stop mice showed abnormal gait compared to controls.
Exp Paradigm: NA
 General observations
 4-28 weeks
Tremor1
Increased
Description: Mecp2-dnic-stop mice showed tremors.
Exp Paradigm: NA
 General observations
 4-28 weeks
Limb posture1
Abnormal
Description: Mecp2-dnic-stop mice showed hindlimb clasping.
Exp Paradigm: NA
 General observations
 4-28 weeks
General locomotor activity1
Abnormal
Description: Mecp2-dnic-stop mice showed abnormal activity compared to controls.
Exp Paradigm: NA
 General observations
 4-28 weeks
Mortality/lethality1
Increased
Description: Mecp2-dnic-stop mice showed increased mortality compared to controls.
Exp Paradigm: NA
 General observations
 0-28 weeks
Targeted expression1
Decreased
Description: Mecp2-dnic-stop mutant mice show reduced protein levels in the brain and in neurons compared to wt controls.
Exp Paradigm: NA
 Flow cytometric analysis
 28 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_MECP2_6_KD

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Self grooming: perseveration1
Increased
Description: Mecp2-sirna injected mice show increase in repetitive self-grooming compared with controls.
Exp Paradigm: NA
 Grooming behavior assessments
 Adult
Social memory1
Decreased
Description: Mecp2-sirna injected mice show decrease in preference for an unfamiliar over a familiar mouse compared with controls.
Exp Paradigm: NA
 U-field assay
 Adult
Social approach1
Decreased
Description: Mecp2-sirna injected mice show significant preference for a social stimulus over an empty cage but the time spent with a social stimulus is significantly less compared with controls.
Exp Paradigm: NA
 Three-chamber social approach test
 Adult
Object recognition memory1
Decreased
Description: Mecp2-sirna injected mice show decrease in time spent with an unfamiliar object over a familiar object compared with controls.
Exp Paradigm: NA
 Object preference test
 Adult
Targeted expression1
Decreased
Description: Mecp2-sirna injected mice show decrease in mecp2 transcript in the dorsal striatum, 2 days after injection.
Exp Paradigm: Striatal tissue was used for qrt pcr.
 Quantitative pcr (qrt-pcr)
 Adult
General locomotor activity: ambulatory activity1
 No change
 Open field test
 Adult
Repetitive digging1
 No change
 Marble-burying test
 Adult
Repetitive digging1
 No change
 Home cage behavior
 Adult
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Emotion, Immune response, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Seizure, Sensory

M_MECP2_51_CKO_HT

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity: ambulatory activity1
Decreased
Description: Mutants show decrease in distance travelled.
Exp Paradigm: NA
 Open field test
 6-8 weeks
Tactile memory1
Decreased
Description: Mutants show decrease in preference for the object with the novel texture.
Exp Paradigm: NA
 Textured novel object recognition test (t-nort)
 6-8 weeks
Sensorimotor gating: tactile cue1
Increased
Description: Mutants show increased responsivity to an air puff stimulus delivered to back hairy skin.
Exp Paradigm: NA
 Response to air puff
 6-8 weeks
Sensorimotor gating: tactile cue1
Increased
Description: Mutants exhibited hairy skin hypersensitivity, measured by an increase of tactile prepulse inhibition of an acoustic startle response assay.
Exp Paradigm: NA
 Prepulse inhibition
 6-8 weeks
Social memory1
Decreased
Description: Mutants spent less time investigating a novel mouse than a familiar mouse.
Exp Paradigm: NA
 Three-chamber social approach test
 6-8 weeks
Social approach1
Decreased
Description: Mutants spent less time investigating a novel mouse than a novel object.
Exp Paradigm: NA
 Three-chamber social approach test
 6-8 weeks
Habituation to aversive stimuli1
Decreased
Description: Mutants show lower percent decrease in startle response to a 125 db noise during a 30-minute tactile ppi session, when comparing the first five startle responses to the last five responses to a 125 db noise for mutant mice and their control littermates, indicating lack of habituation to an acoustic startle noise.
Exp Paradigm: NA
 Prepulse inhibition
 6-8 weeks
Anxiety1
Increased
Description: Mutants spent less time in the open arms.
Exp Paradigm: NA
 Elevated plus maze test
 6-8 weeks
Anxiety1
Increased
Description: Mutants spent less time in the center of the open field.
Exp Paradigm: NA
 Open field test
 6-8 weeks
Exploratory activity1
 No change
 Novel object recognition test
 6-8 weeks
Object recognition memory: long-term recall1
 No change
 Novel object recognition test
 6-8 weeks
General locomotor activity1
 No change
 Elevated plus maze test
 6-8 weeks
Repetitive digging1
 No change
 Marble-burying test
 6-8 weeks
Sensorimotor gating1
 No change
 Prepulse inhibition
 6-8 weeks
Startle response: acoustic stimulus1
 No change
 Acoustic startle reflex test
 6-8 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Maternal behavior, Molecular profile, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Seizure

M_MECP2_52_CKO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity: ambulatory activity1
Decreased
Description: Mutants show decrease in distance travelled.
Exp Paradigm: NA
 Open field test
 6-8 weeks
Neuroreceptor levels: gaba-r: gabaa1
Decreased
Description: Mutants show decrease in the levels of gabrb3 expression in low-threshold mechanoreceptor neuron (ltmr) central terminals at spinal cord dorsal horn lamina iii/iv in vglut1+ presynaptic terminals.
Exp Paradigm: Spinal cord
 Immunohistochemistry
 Adult
Neuronal number: interneurons1
Increased
Description: Mutants show increase in number of parvalbumin positive interneurons in primary somatosensory cortex, but not primary visual cortex. mutants show decrease in number of parvalbumin positive interneurons in the basolateral amygdala.
Exp Paradigm: Primary somatosensory cortex, primary visual cortex
 Immunohistochemistry
 Adult
Morphology of the spinal cord: sensory and motor tracts1
Decreased
Description: Mutants show decrease in hcn1 expression at spinal cord dorsal horn lamina iii/iv in vglut1+ presynaptic terminals, in large but not small diameter drg cell bodies.
Exp Paradigm: Spinal cord
 Immunohistochemistry
 Adult
Spontaneous post synaptic event frequency: inhibitory currents1
Increased
Description: Mutants show increase in spontaneous inhibitory postsynaptic current (sipsc) frequency in layer 2/3 pyramidal neurons from acute primary somatosensory cortex slices resulting in a decrease in e/i ratio. mutants show no change in spontaneous inhibitory postsynaptic current (sipsc) frequency in the visual cortex.
Exp Paradigm: Primary somatosensory cortex, primary visual cortex
 Whole-cell patch clamp
 Adult
Repetitive digging1
Decreased
Description: Mutants show decrease in the number of marbles buried.
Exp Paradigm: NA
 Marble-burying test
 6-8 weeks
Sensorimotor gating: tactile cue1
Increased
Description: Mutants exhibited hairy skin hypersensitivity, measured by an increase of tactile prepulse inhibition of an acoustic startle response assay.
Exp Paradigm: NA
 Prepulse inhibition
 6-8 weeks
Tactile memory1
Decreased
Description: Mutants show decrease in preference for the object with the novel texture.
Exp Paradigm: NA
 Textured novel object recognition test (t-nort)
 6-8 weeks
Sensorimotor gating: tactile cue1
Increased
Description: Mutants show increased responsivity to an air puff stimulus delivered to back hairy skin.
Exp Paradigm: NA
 Response to air puff
 6-8 weeks
Social memory1
Decreased
Description: Mutants spent less time investigating a novel mouse than a familiar mouse.
Exp Paradigm: NA
 Three-chamber social approach test
 6-8 weeks
Social approach1
Decreased
Description: Mutants spent less time investigating a novel mouse than a novel object.
Exp Paradigm: NA
 Three-chamber social approach test
 6-8 weeks
Habituation to aversive stimuli1
Decreased
Description: Mutants show lower percent decrease in startle response to a 125 db noise during a 30-minute tactile ppi session, when comparing the first five startle responses to the last five responses to a 125 db noise for mutant mice and their control littermates, indicating lack of habituation to an acoustic startle noise.
Exp Paradigm: NA
 Prepulse inhibition
 6-8 weeks
Anxiety1
Increased
Description: Mutants spent less time in the open arms.
Exp Paradigm: NA
 Elevated plus maze test
 6-8 weeks
Anxiety1
Increased
Description: Mutants spent less time in the center of the open field.
Exp Paradigm: NA
 Open field test
 6-8 weeks
Exploratory activity1
 No change
 Novel object recognition test
 6-8 weeks
Object recognition memory: long-term recall1
 No change
 Novel object recognition test
 6-8 weeks
General locomotor activity1
 No change
 Elevated plus maze test
 6-8 weeks
Spontaneous post synaptic event amplitude: excitatory currents1
 No change
 Whole-cell patch clamp
 Adult
Spontaneous post synaptic event amplitude: inhibitory currents1
 No change
 Whole-cell patch clamp
 Adult
Spontaneous post synaptic event frequency: excitatory currents1
 No change
 Whole-cell patch clamp
 Adult
Self grooming: perseveration1
 No change
 Open field test
 6-8 weeks
Sensorimotor gating1
 No change
 Prepulse inhibition
 6-8 weeks
Startle response: acoustic stimulus1
 No change
 Acoustic startle reflex test
 6-8 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Maternal behavior, Molecular profile, Physiological parameters, Seizure

M_MECP2_53_KO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity: ambulatory activity1
Decreased
Description: Mutants show decrease in distance travelled.
Exp Paradigm: NA
 Open field test
 6-8 weeks
Neuronal number: interneurons1
Abnormal
Description: Mutants show increase of parvalbumin positive interneurons in the primary somatosensory cortex and in the primary visual cortex but decrease in parvalbumin positive interneurons in the basolateral amygdala.
Exp Paradigm: Primary somatosensory cortex, primary visual cortex
 Immunohistochemistry
 Adult
Intrinsic membrane properties1
Increased
Description: Mutants show a small increase in excitability of large diameter neurons, measured by a decrease in rheobase.
Exp Paradigm: Spinal cord
 Whole-cell current clamp
 Adult
Repetitive digging1
Decreased
Description: Mutants show decrease in the number of marbles buried.
Exp Paradigm: NA
 Marble-burying test
 6-8 weeks
Sensorimotor gating: tactile cue1
Increased
Description: Mutants show increased responsivity to an air puff stimulus delivered to back hairy skin.
Exp Paradigm: NA
 Response to air puff
 6 weeks
Sensorimotor gating1
Increased
Description: Mutants show increase in percent inhibition of the startle response to a 125 db noise pulse when the startle noise is preceded by an 80 db tone prepulse.
Exp Paradigm: NA
 Prepulse inhibition
 6 weeks
Tactile memory1
Decreased
Description: Mutants show decrease in preference for the object with the novel texture.
Exp Paradigm: NA
 Textured novel object recognition test (t-nort)
 6 weeks
Startle response: acoustic stimulus1
Decreased
Description: Mutants show decrease in amplitude of startle response to a 125 db startling noise but not to a 80db non-startling noise pulse.
Exp Paradigm: NA
 Acoustic startle reflex test
 6 weeks
Social memory1
Decreased
Description: Mutants spent less time investigating a novel mouse than a familiar mouse.
Exp Paradigm: NA
 Three-chamber social approach test
 6 weeks
Social approach1
Decreased
Description: Mutants spent less time investigating a novel mouse than a novel object.
Exp Paradigm: NA
 Three-chamber social approach test
 6 weeks
Habituation to aversive stimuli1
Decreased
Description: Mutants show lower percent decrease in startle response to a 125 db noise during a 30-minute tactile ppi session, when comparing the first five startle responses to the last five responses to a 125 db noise for mutant mice and their control littermates, indicating lack of habituation to an acoustic startle noise.
Exp Paradigm: NA
 Prepulse inhibition
 6-8 weeks
Anxiety1
Increased
Description: Mutants spent less time in the open arms.
Exp Paradigm: NA
 Elevated plus maze test
 6 weeks
Anxiety1
Increased
Description: Mutants spent less time in the center of the open field.
Exp Paradigm: NA
 Open field test
 6 weeks
Object recognition memory: long-term recall1
Decreased
Description: Mutants show no decrease in preference for an object with a novel shape after 1 hour retention but not after 5 min retention.
Exp Paradigm: NA
 Novel object recognition test
 6 weeks
Exploratory activity1
 No change
 Novel object recognition test
 6 weeks
General locomotor activity1
 No change
 Elevated plus maze test
 6-8 weeks
Action potential property: firing rate1
 No change
 Whole-cell voltage clamp
 Adult
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Maternal behavior, Molecular profile, Physiological parameters, Seizure

M_MECP2_54_CKO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity: ambulatory activity1
Decreased
Description: Mutants show decrease in distance travelled.
Exp Paradigm: NA
 Open field test
 6-8 weeks
Neuronal number: interneurons1
Abnormal
Description: Mutants show increase in number of parvalbumin positive interneurons in primary somatosensory cortex, but not primary visual cortex. mutants show decrease in number of parvalbumin positive interneurons in the basolateral amygdala.
Exp Paradigm: Primary somatosensory cortex, primary visual cortex, basolateral amygdala
 Immunohistochemistry
 6 weeks
Repetitive digging1
Decreased
Description: Mutants show decrease in the number of marbles buried.
Exp Paradigm: NA
 Marble-burying test
 6-8 weeks
Sensorimotor gating: tactile cue1
Increased
Description: Mutants exhibited hairy skin hypersensitivity, measured by an increase of tactile prepulse inhibition of an acoustic startle response assay.
Exp Paradigm: NA
 Prepulse inhibition
 6 weeks
Tactile memory1
Decreased
Description: Mutants show decrease in preference for the object with the novel texture.
Exp Paradigm: NA
 Textured novel object recognition test (t-nort)
 6 weeks
Sensorimotor gating: tactile cue1
Increased
Description: Mutants show increased responsivity to an air puff stimulus delivered to back hairy skin.
Exp Paradigm: NA
 Response to air puff
 6 weeks
Social approach1
Decreased
Description: Mutants spent less time investigating a novel mouse than a novel object.
Exp Paradigm: NA
 Three-chamber social approach test
 6 weeks
Social memory1
Decreased
Description: Mutants spent less time investigating a novel mouse than a familiar mouse.
Exp Paradigm: NA
 Three-chamber social approach test
 6 weeks
Habituation to aversive stimuli1
Decreased
Description: Mutants show lower percent decrease in startle response to a 125 db noise during a 30-minute tactile ppi session, when comparing the first five startle responses to the last five responses to a 125 db noise for mutant mice and their control littermates, indicating lack of habituation to an acoustic startle noise.
Exp Paradigm: NA
 Prepulse inhibition
 6-8 weeks
Anxiety1
Increased
Description: Mutants spent less time in the open arms.
Exp Paradigm: NA
 Elevated plus maze test
 6 weeks
Anxiety1
Increased
Description: Mutants spent less time in the center of the open field.
Exp Paradigm: NA
 Open field test
 6 weeks
Exploratory activity1
 No change
 Novel object recognition test
 6 weeks
Object recognition memory: long-term recall1
 No change
 Novel object recognition test
 6 weeks
General locomotor activity1
 No change
 Elevated plus maze test
 6-8 weeks
Sensorimotor gating1
 No change
 Prepulse inhibition
 6 weeks
Startle response: acoustic stimulus1
 No change
 Acoustic startle reflex test
 6 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Maternal behavior, Molecular profile, Neurophysiology, Physiological parameters, Seizure

M_MECP2_55_CKO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity: ambulatory activity1
Increased
Description: Mutants show increase in distance travelled.
Exp Paradigm: NA
 Open field test
 6-8 weeks
Neuronal number: interneurons1
Abnormal
Description: Mutants show decrease in number of parvalbumin positive interneurons in primary somatosensory cortex, but not primary visual cortex. mutants show increase in number of parvalbumin positive interneurons in the basolateral amygdala.
Exp Paradigm: Primary somatosensory cortex, primary visual cortex, basolateral amygdala
 Immunohistochemistry
 6 weeks
Repetitive digging1
Increased
Description: Mutants show increase in the number of marbles buried.
Exp Paradigm: NA
 Marble-burying test
 6-8 weeks
Sensorimotor gating: tactile cue1
Increased
Description: Mutants exhibited hairy skin hypersensitivity, measured by an increase of tactile prepulse inhibition of an acoustic startle response assay.
Exp Paradigm: NA
 Prepulse inhibition
 6 weeks
Tactile memory1
Decreased
Description: Mutants show decrease in preference for the object with the novel texture.
Exp Paradigm: NA
 Textured novel object recognition test (t-nort)
 6 weeks
Sensorimotor gating: tactile cue1
Increased
Description: Mutants show increased responsivity to an air puff stimulus delivered to back hairy skin.
Exp Paradigm: NA
 Response to air puff
 6 weeks
Social approach1
Decreased
Description: Mutants spent less time investigating a novel mouse than a novel object.
Exp Paradigm: NA
 Three-chamber social approach test
 6 weeks
Social memory1
Decreased
Description: Mutants spent less time investigating a novel mouse than a familiar mouse.
Exp Paradigm: NA
 Three-chamber social approach test
 6 weeks
Habituation to aversive stimuli1
Decreased
Description: Mutants show lower percent decrease in startle response to a 125 db noise during a 30-minute tactile ppi session, when comparing the first five startle responses to the last five responses to a 125 db noise for mutant mice and their control littermates, indicating lack of habituation to an acoustic startle noise.
Exp Paradigm: NA
 Prepulse inhibition
 6-8 weeks
Anxiety1
Decreased
Description: Mutants spent more time in the open arms.
Exp Paradigm: NA
 Elevated plus maze test
 6 weeks
Anxiety1
Decreased
Description: Mutants spent more time in the center of the open field.
Exp Paradigm: NA
 Open field test
 6 weeks
Exploratory activity1
 No change
 Novel object recognition test
 6 weeks
Object recognition memory: long-term recall1
 No change
 Novel object recognition test
 6 weeks
General locomotor activity1
 No change
 Elevated plus maze test
 6-8 weeks
Sensorimotor gating1
 No change
 Prepulse inhibition
 6 weeks
Startle response: acoustic stimulus1
 No change
 Acoustic startle reflex test
 6 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Maternal behavior, Molecular profile, Neurophysiology, Physiological parameters, Seizure

M_MECP2_56_CKO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Neuronal number: interneurons1
Abnormal
Description: Mutants show decrease in number of parvalbumin positive interneurons in primary somatosensory cortex, but not primary visual cortex or in the basolateral amygdala.
Exp Paradigm: Primary somatosensory cortex, primary visual cortex, basolateral amygdala
 Immunohistochemistry
 6 weeks
Repetitive digging1
Decreased
Description: Mutants show decrease in the number of marbles buried.
Exp Paradigm: NA
 Marble-burying test
 6-8 weeks
Sensorimotor gating: tactile cue1
Increased
Description: Mutants exhibited hairy skin hypersensitivity, measured by an increase of tactile prepulse inhibition of an acoustic startle response assay.
Exp Paradigm: NA
 Prepulse inhibition
 6 weeks
Tactile memory1
Decreased
Description: Mutants show decrease in preference for the object with the novel texture.
Exp Paradigm: NA
 Textured novel object recognition test (t-nort)
 6 weeks
Sensorimotor gating: tactile cue1
Increased
Description: Mutants show increased responsivity to an air puff stimulus delivered to back hairy skin.
Exp Paradigm: NA
 Response to air puff
 6 weeks
Social memory1
Decreased
Description: Mutants spent less time investigating a novel mouse than a familiar mouse.
Exp Paradigm: NA
 Three-chamber social approach test
 6 weeks
Social approach1
Decreased
Description: Mutants spent less time investigating a novel mouse than a novel object.
Exp Paradigm: NA
 Three-chamber social approach test
 6 weeks
Anxiety1
 No change
 Open field test
 6 weeks
Anxiety1
 No change
 Elevated plus maze test
 6 weeks
Exploratory activity1
 No change
 Novel object recognition test
 6 weeks
Habituation to aversive stimuli1
 No change
 Prepulse inhibition
 6-8 weeks
Object recognition memory: long-term recall1
 No change
 Novel object recognition test
 6 weeks
General locomotor activity1
 No change
 Elevated plus maze test
 6-8 weeks
General locomotor activity: ambulatory activity1
 No change
 Open field test
 6-8 weeks
Sensorimotor gating1
 No change
 Prepulse inhibition
 6 weeks
Startle response: acoustic stimulus1
 No change
 Acoustic startle reflex test
 6 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Maternal behavior, Molecular profile, Neurophysiology, Physiological parameters, Seizure

M_MECP2_57_KI_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity: ambulatory activity1
Decreased
Description: Mutants show decrease in distance travelled.
Exp Paradigm: NA
 Open field test
 6 weeks
Neuronal number: interneurons1
Increased
Description: Mutants show increased parvalbumin positive neurons in the primary somatosensory cortex and in the visual cortex but not in the basolateral amygdala.
Exp Paradigm: NA
 Immunohistochemistry
 6 weeks
Neuronal number: interneurons1
Decreased
Description: Mutants show decrease in the number of interneurons in the basolateral amygdala.
Exp Paradigm: NA
 Immunohistochemistry
 6 weeks
Neuroreceptor levels: gaba-r: gabaa1
Decreased
Description: Mutants show decreased expression of gabrb3 expression in the spinal cord dorsal horn lamina iii/iv.
Exp Paradigm: Spinal cord
 Immunohistochemistry
 6 weeks
Synaptic transmission1
Decreased
Description: Mutants show decrease in excitatory to inhibitory ratio in primary somatosensory cortex slices.
Exp Paradigm: Primary somatosensory cortex
 Whole-cell patch clamp
 6 weeks
Synaptic transmission1
Decreased
Description: Mutants show decrease in excitatory to inhibitory ratio in primary somatosensory cortex slices.
Exp Paradigm: NA
 Whole-cell patch clamp
 6 weeks
Spontaneous post synaptic event frequency: inhibitory currents1
Abnormal
Description: Mutants show increase in sipsc frequency in the primary visual cortex but not in the somatosensory cortex.
Exp Paradigm: NA
 Whole-cell patch clamp
 6 weeks
Repetitive digging1
Decreased
Description: Mutants show decrease in the number of marbles buried.
Exp Paradigm: NA
 Marble-burying test
 6 weeks
Sensorimotor gating: tactile cue1
Increased
Description: Mutants show increase in response to air puff.
Exp Paradigm: NA
 Response to air puff
 6 weeks
Tactile memory1
Decreased
Description: Mutants show decreased preference for object with novel texture.
Exp Paradigm: NA
 Textured novel object recognition test (t-nort)
 6 weeks
Sensorimotor gating1
Increased
Description: Mutants show increased percent prepulse inhibition of the startle response to a 125 db noise, when the startle noise is preceded by a prepulse at 80db.
Exp Paradigm: NA
 Prepulse inhibition
 6 weeks
Startle response: acoustic stimulus1
Decreased
Description: Mutants show decrease in amplitude of startle response to a 125 db startling noise but not to a 80db non-startling noise pulse.
Exp Paradigm: NA
 Acoustic startle reflex test
 6 weeks
Sensorimotor gating: tactile cue1
Increased
Description: Mutants show increased percent inhibition of the startle response to a 125 db noise, when the startle noise is preceded by a light air puff.
Exp Paradigm: NA
 Prepulse inhibition
 6 weeks
Social approach1
Decreased
Description: Mutants show decrease in preference for novel mouse over novel object.
Exp Paradigm: NA
 Three-chamber social approach test
 6 weeks
Social memory1
Decreased
Description: Mutants show decrease in preference for novel mouse over familiar mouse.
Exp Paradigm: NA
 Three-chamber social approach test
 6 weeks
Social approach1
Decreased
Description: Mutants show decrease in the preference for novel mouse over novel object.
Exp Paradigm: NA
 Three-chamber social approach test
 6 weeks
Size/growth1
Decreased
Description: Mutants show reduced body weight.
Exp Paradigm: NA
 Body weight measurement
 NA
General characteristics1
Decreased
Description: Mutants show dull eyes, dull/ungroomed coat and somewhat hunched stance.
Exp Paradigm: A score of 0 indicated a clean shiny coat, clear eyes and normal stance. a score of 1 indicated the appearance of dull eyes, dull/ungroomed coat and somewhat hunched stance. a score of 2 denoted narrowed or crusted eyes, piloerection and a hunched posture. a score of 3 indicated severe eye narrowing, profound piloerection or loss of fur, and severely hunched posture.
 Macroscopic analysis
 3 weeks
Anxiety1
Increased
Description: Mutants show decrease in time spent in the center.
Exp Paradigm: NA
 Open field test
 6 weeks
Habituation to aversive stimuli1
Decreased
Description: Mutants show decreased startle amplitude to a 125 db noise during a 30-minute tactile ppi session, when comparing the first five startle responses to the last five responses to a 125 db noise.
Exp Paradigm: NA
 Prepulse inhibition
 6 weeks
Exploratory activity1
Increased
Description: Mutants show increase in time spent investigating objects.
Exp Paradigm: NA
 Novel object recognition test
 6 weeks
Anxiety1
Increased
Description: Mutants show decrease in time spent in the open arms.
Exp Paradigm: NA
 Elevated plus maze test
 6 weeks
Object recognition memory: long-term recall1
Decreased
Description: Mutants show decrease in preference for object with novel shape after 1 hour retention but not after 5 min retention.
Exp Paradigm: NA
 Novel object recognition test
 6 weeks
Exploratory activity1
 No change
 Novel object recognition test
 6 weeks
General locomotor activity1
 No change
 Elevated plus maze test
 6 weeks
Spontaneous post synaptic event amplitude: excitatory currents1
 No change
 Whole-cell patch clamp
 6 weeks
Spontaneous post synaptic event amplitude: inhibitory currents1
 No change
 Whole-cell patch clamp
 6 weeks
Spontaneous post synaptic event frequency: excitatory currents1
 No change
 Whole-cell patch clamp
 6 weeks
Self grooming: perseveration1
 No change
 Grooming behavior assessments
 6 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Maternal behavior, Molecular profile, Physiological parameters, Seizure

M_MECP2_58_KI_HT

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity: ambulatory activity1
Decreased
Description: Mutants show decrease in distance travelled.
Exp Paradigm: NA
 Open field test
 6 weeks
Neuronal number: interneurons1
Increased
Description: Mutants show increase in parvalbumin positive interneurons in the primary somatosensory cortex and the visual cortex but decreased parvalbumin positive neurons in the basolateral amygdala in mutants.
Exp Paradigm: NA
 Immunohistochemistry
 6 weeks
Synaptic transmission1
Decreased
Description: Mutants show decrease in excitatory to inhibitory ratio in primary somatosensory cortex slices.
Exp Paradigm: Primary somatosensory cortex
 Whole-cell patch clamp
 6 weeks
Spontaneous post synaptic event frequency: inhibitory currents1
Increased
Description: Mutants show increase in sipsc frequency in the primary visual cortex and the somatosensory cortex.
Exp Paradigm: NA
 Whole-cell patch clamp
 6 weeks
Repetitive digging1
Decreased
Description: Mutants show decrease in the number of marbles buried.
Exp Paradigm: NA
 Marble-burying test
 6 weeks
Sensorimotor gating: tactile cue1
Increased
Description: Mutants show increased percent inhibition of the startle response to a 125 db noise, when the startle noise is preceded by a light air puff.
Exp Paradigm: NA
 Prepulse inhibition
 6 weeks
Sensorimotor gating: tactile cue1
Increased
Description: Mutants show increase in response to air puff.
Exp Paradigm: NA
 Response to air puff
 6 weeks
Tactile memory1
Decreased
Description: Mutants show decreased preference for object with novel texture.
Exp Paradigm: NA
 Textured novel object recognition test (t-nort)
 6 weeks
Sensorimotor gating1
Increased
Description: Mutants show increased percent prepulse inhibition of the startle response to a 125 db noise, when the startle noise is preceded by a prepulse at 80db.
Exp Paradigm: NA
 Prepulse inhibition
 6 weeks
Startle response: acoustic stimulus1
Decreased
Description: Mutants show decrease in startle response to 125db startle response but not in response to acoustic prepulse.
Exp Paradigm: NA
 Acoustic startle reflex test
 6 weeks
Social approach1
Decreased
Description: Mutants show decrease in preference for novel mouse over novel object.
Exp Paradigm: NA
 Three-chamber social approach test
 6 weeks
Social memory1
Decreased
Description: Mutants show decrease in preference for novel mouse over familiar mouse.
Exp Paradigm: NA
 Three-chamber social approach test
 6 weeks
Social approach1
Decreased
Description: Mutants show decrease in the preference for novel mouse over novel object.
Exp Paradigm: NA
 Three-chamber social approach test
 6 weeks
Size/growth1
Decreased
Description: Mutants show reduced body weight.
Exp Paradigm: NA
 Body weight measurement
 NA
General characteristics1
Decreased
Description: Mutants show dull eyes, dull/ungroomed coat and somewhat hunched stance.
Exp Paradigm: A score of 0 indicated a clean shiny coat, clear eyes and normal stance. a score of 1 indicated the appearance of dull eyes, dull/ungroomed coat and somewhat hunched stance. a score of 2 denoted narrowed or crusted eyes, piloerection and a hunched posture. a score of 3 indicated severe eye narrowing, profound piloerection or loss of fur, and severely hunched posture.
 Macroscopic analysis
 3 weeks
Anxiety1
Increased
Description: Mutants show decrease in time spent in the center.
Exp Paradigm: NA
 Open field test
 6 weeks
Habituation to aversive stimuli1
Decreased
Description: Mutants show decreased startle amplitude to a 125 db noise during a 30-minute tactile ppi session, when comparing the first five startle responses to the last five responses.
Exp Paradigm: NA
 Prepulse inhibition
 6 weeks
Anxiety1
Increased
Description: Mutants show decrease in time spent in the open arms.
Exp Paradigm: NA
 Elevated plus maze test
 6 weeks
Object recognition memory: long-term recall1
Decreased
Description: Mutants show decrease in preference for object with novel shape after 1 hour retention but not after 5min retention.
Exp Paradigm: NA
 Novel object recognition test
 6 weeks
Mortality/lethality1
 No change
 Survival analysis
 6 weeks
Exploratory activity1
 No change
 Novel object recognition test
 6 weeks
General locomotor activity1
 No change
 Elevated plus maze test
 6 weeks
Spontaneous post synaptic event amplitude: excitatory currents1
 No change
 Whole-cell patch clamp
 6 weeks
Spontaneous post synaptic event amplitude: inhibitory currents1
 No change
 Whole-cell patch clamp
 6 weeks
Spontaneous post synaptic event frequency: excitatory currents1
 No change
 Whole-cell patch clamp
 6 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Maternal behavior, Molecular profile, Physiological parameters, Seizure

M_MECP2_10_PME_HIPPOCAMPUS

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Social memory1
Decreased
Description: Male mutants show no preference for an unfamiliar mouse over a familiar mouse.
Exp Paradigm: NA
 Three-chamber social approach test
 3-18 weeks
Social transmission of food preference1
Decreased
Description: Mutants failed to acquire the food preference of another mouse following 30 min co-housing.
Exp Paradigm: NA
 Social transmission of food preference
 3-18 weeks
Anxiety1
Increased
Description: Mutants spent less time in the open arms.
Exp Paradigm: NA
 Elevated plus maze test
 3-18 weeks
Object recognition memory1
Decreased
Description: Mutants spent less time playing with a novel object.
Exp Paradigm: NA
 Novel object recognition test
 3-18 weeks
Depression1
 No change
 Tail suspension test
 3-18 weeks
General locomotor activity: ambulatory activity1
 No change
 Open field test
 3-18 weeks
Self grooming: perseveration1
 No change
 Grooming behavior assessments
 3-18 weeks
Social approach1
 No change
 Three-chamber social approach test
 3-18 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Maternal behavior, Molecular profile, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Seizure, Sensory

M_MECP2_9_PME

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity: ambulatory activity1
Decreased
Description: Mutants travel shorter distances.
Exp Paradigm: NA
 Open field test
 3-18 weeks
Self grooming: perseveration1
Increased
Description: Male mutants spent more time self-grooming.
Exp Paradigm: NA
 Grooming behavior assessments
 3-18 weeks
Social transmission of food preference1
Decreased
Description: Mutants failed to acquire the food preference of another mouse following 30 min co-housing.
Exp Paradigm: NA
 Social transmission of food preference
 3-18 weeks
Social memory1
Decreased
Description: Male mutants show no preference for an unfamiliar mouse over a familiar mouse.
Exp Paradigm: NA
 Three-chamber social approach test
 3-18 weeks
Depression1
Increased
Description: Mutants spend more time immobile.
Exp Paradigm: NA
 Tail suspension test
 3-18 weeks
Anxiety1
Increased
Description: Mutants spent less time in the open arms.
Exp Paradigm: NA
 Elevated plus maze test
 3-18 weeks
Object recognition memory1
Decreased
Description: Mutants spent less time playing with a novel object.
Exp Paradigm: NA
 Novel object recognition test
 3-18 weeks
Targeted expression1
Decreased
Description: Male mutants show decreased mecp2 transcript expression in the hippocampus and parietal cortex.
Exp Paradigm: NA
 Quantitative pcr (qrt-pcr)
 3-18 weeks
Targeted expression1
Decreased
Description: Male mutants show decreased mecp2 protein expression in the hippocampus and parietal cortex.
Exp Paradigm: NA
 Immunofluorescence staining
 3-18 weeks
Dna methylation1
Increased
Description: Male mutants show increased mecp2 promoter methylation in tail samples and in the parietal cortex, hippocampus, heart, liver, kidney, lung, and testis.
Exp Paradigm: NA
 Cpg methylomics analysis
 3-18 weeks
Dna methylation1
 No change
 Cpg methylomics analysis
 3-18 weeks
Social approach1
 No change
 Three-chamber social approach test
 3-18 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Maternal behavior, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Seizure, Sensory

M_MECP2_59_TG_2X

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Motor learning1
Increased
Description: Increased latency to fall
 Accelerating rotarod test
 4-5 months
Dendritic architecture: spine turnover1
Decreased
Description: Increased clustered-spine stabilization
 Two-photon microscopy
 12-14 weeks
Signaling: MAPK pathway
Increased
Description: Marked hyperphosphorylation of the map kinase erk1/2 (t202/y204) upon rotarod training; basal phosphorylation state of erk was not significantly altered in mutant m1 lysates without training; level of phosphorylation did not correlate with the latency
 
 
 Not Reported:


Interactor Symbol Interactor Name Interactor Organism Entrez ID Uniprot ID Interaction Type Evidence Reference
7-Sep septin 7 989 A8K3D0 ChIP
Ballestar E , et al. 2004
ABCB1 ATP-binding cassette, sub-family B (MDR/TAP), member 1 5243 A4D1D2 ChIP
El-Osta A and Wolffe AP 2001
ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 9429 Q9UNQ0 ChIP
To KK , et al. 2006
ACTL6A actin-like 6A 86 O96019 IP; LC-MS/MS
Tsujimura K , et al. 2015
ADAM12 ADAM metallopeptidase domain 12 8038 O43184 Supershift assay; ChIP
Ray BK , et al. 2012
ADORA2A adenosine A2a receptor 135 P29274 ChIP
Buira SP , et al. 2009
ANKRD2 ankyrin repeat domain 2 (stretch responsive muscle) 26287 Q9GZV1 Protein microarray; GST; DNA affinity precipitation
Belgrano A , et al. 2011
APOE apolipoprotein E 348 P02649 ChIP
Ballestar E , et al. 2003
Arx aristaless related homeobox 170302 Q96QS3 ChIP
Dhawan S , et al. 2011
BAZ1A bromodomain adjacent to zinc finger domain, 1A 11177 Q9NRL2 IP; LC-MS/MS
Huttlin EL , et al. 2015
BBX bobby sox homolog (Drosophila) 56987 A8K6U2 IP; LC-MS/MS
Huttlin EL , et al. 2015
BIRC2 baculoviral IAP repeat containing 2 329 Q13490 ChIP
Ballestar E , et al. 2004
BLM Bloom syndrome, RecQ helicase-like 641 P54132 IP; LC-MS/MS
Huttlin EL , et al. 2015
BRD4 bromodomain containing 4 23476 O60885 ChIP-chip
Yasui DH , et al. 2007
BRIX1 BRX1, biogenesis of ribosomes, homolog (S. cerevisiae) 55299 Q8TDN6 IP; LC-MS/MS
Huttlin EL , et al. 2015
BRSK2 BR serine/threonine kinase 2 9024 Q8IWQ3 ChIP-chip
Yasui DH , et al. 2007
C10ORF2 chromosome 10 open reading frame 2 56652 Q96RR1 IP; LC-MS/MS
Huttlin EL , et al. 2015
C11ORF57 chromosome 11 open reading frame 57 55216 Q6ZUT1 IP; LC-MS/MS
Huttlin EL , et al. 2015
C18ORF21 UPF0711 protein C18orf21 83608 Q32NC0 IP; LC-MS/MS
Huttlin EL , et al. 2015
C3ORF17 chromosome 3 open reading frame 17 25871 Q6NW34 IP; LC-MS/MS
Huttlin EL , et al. 2015
C9ORF114 chromosome 9 open reading frame 114 51490 Q5T280 IP; LC-MS/MS
Huttlin EL , et al. 2015
CBX3 chromobox homolog 3 11335 Q13185 ChIP
Agarwal N , et al. 2007
CCNA2 cyclin A2 890 P20248 ChIP
Jamaluddin MD , et al. 2007
CD70 CD70 molecule 970 P32970 ChIP
Zhou Y , et al. 2011
Cdk10 cyclin-dependent kinase 10 234854 Q0VH02 RNA immunoprecipitation (RIP)
Long SW , et al. 2010
CDK5 cyclin-dependent kinase 5 1020 Q00535 in vivo kinase assay
Liang Z , et al. 2015
CDK5R1 cyclin-dependent kinase 5, regulatory subunit 1 (p35) 8851 Q15078 in vivo kinase assay
Liang Z , et al. 2015
CDKL5 cyclin-dependent kinase-like 5 6792 O76039 GST; IP/WB
Mari F , et al. 2005
CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 1029 P42771 ChIP
Lin RK , et al. 2006
CEBPA CCAAT/enhancer binding protein (C/EBP), alpha 1050 P49715 ChIP
Tada Y , et al. 2006
CEBPZ CCAAT/enhancer binding protein (C/EBP), zeta 10153 Q03701 IP; LC-MS/MS
Huttlin EL , et al. 2015
CENPV centromere protein V 201161 Q7Z7K6 IP; LC-MS/MS
Huttlin EL , et al. 2015
CHMP1A charged multivesicular body protein 1A 5119 A6NG32 IP; LC-MS/MS
Huttlin EL , et al. 2015
CHRFAM7A CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion 89832 Q494W8 ChIP-chip
Yasui DH , et al. 2011
CHRNA7 cholinergic receptor, nicotinic, alpha 7 (neuronal) 1139 P36544 ChIP-chip
Yasui DH , et al. 2011
CHUK conserved helix-loop-helix ubiquitous kinase 1147 O15111 IP/WB; in vitro kinase assay
Khoshnan A and Patterson PH 2012
CLU clusterin 1191 P10909 ChIP
Gibson JH , et al. 2010
CRMP1 collapsin response mediator protein 1 1400 B3KT07 ChIP
Gibson JH , et al. 2010
CROCC ciliary rootlet coiled-coil, rootletin 9696 Q5TZA2 ChIP
Artuso R , et al. 2011
CSE1L CSE1 chromosome segregation 1-like (yeast) 1434 P55060 ChIP
Ballestar E , et al. 2004
CTCF CCCTC-binding factor (zinc finger protein) 10664 B5MC38 ChIP
Nagarajan RP , et al. 2009
DDX21 DEAD (Asp-Glu-Ala-Asp) box helicase 21 9188 Q9NR30 IP; LC-MS/MS
Huttlin EL , et al. 2015
DDX23 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 9416 Q9BUQ8 IP; LC-MS/MS
Tsujimura K , et al. 2015
DDX24 DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 57062 Q9GZR7 IP; LC-MS/MS
Huttlin EL , et al. 2015
DDX25 DEAD (Asp-Glu-Ala-Asp) box helicase 25 29118 Q9UHL0 IP; LC-MS/MS
Tsujimura K , et al. 2015
DDX27 DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 55661 Q96GQ7 IP; LC-MS/MS
Tsujimura K , et al. 2015
DDX31 DEAD (Asp-Glu-Ala-Asp) box polypeptide 31 64794 Q9H8H2 IP; LC-MS/MS
Huttlin EL , et al. 2015
DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1654 O00571 IP; LC-MS/MS
Tsujimura K , et al. 2015
DDX50 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 79009 Q9BQ39 IP; LC-MS/MS
Tsujimura K , et al. 2015
DDX51 DEAD (Asp-Glu-Ala-Asp) box polypeptide 51 317781 Q8N8A6 IP; LC-MS/MS
Huttlin EL , et al. 2015
DDX54 DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 79039 Q8TDD1 IP; LC-MS/MS
Huttlin EL , et al. 2015
DDX56 DEAD (Asp-Glu-Ala-Asp) box helicase 56 54606 Q9NY93 IP; LC-MS/MS
Huttlin EL , et al. 2015
DGCR8 DiGeorge syndrome critical region gene 8 54487 Q8WYQ5 IP; LC-MS/MS
Huttlin EL , et al. 2015
DHX16 DEAH (Asp-Glu-Ala-His) box polypeptide 16 8449 O60231 IP; LC-MS/MS
Tsujimura K , et al. 2015
DHX30 DEAH (Asp-Glu-Ala-His) box polypeptide 30 22907 Q7L2E3 IP; LC-MS/MS
Tsujimura K , et al. 2015
DHX36 DEAH (Asp-Glu-Ala-His) box polypeptide 36 170506 Q9H2U1 IP; LC-MS/MS
Tsujimura K , et al. 2015
DHX37 DEAH (Asp-Glu-Ala-His) box polypeptide 37 57647 Q8IY37 IP; LC-MS/MS
Tsujimura K , et al. 2015
DHX9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 1660 Q08211 IP; LC-MS/MS
Tsujimura K , et al. 2015
DLX5 distal-less homeobox 5 1749 P56178 ChIP; WB; qRT-PCR; Southern blot; ChIP-loop assay
Horike S , et al. 2004
DLX6 distal-less homeobox 6 1750 J3KR92 ChIP; WB; qRT-PCR; Southern blot; ChIP-loop assay
Horike S , et al. 2004
DNM1 dynamin 1 1759 Q05193 ChIP
Gibson JH , et al. 2010
E2F1 E2F transcription factor 1 1869 Q01094 Luciferase reporter assay
Matsumura S , et al. 2009
EGR2 early growth response 2 1959 P11161 ChIP
Swanberg SE , et al. 2008
EIF2AK2 eukaryotic translation initiation factor 2-alpha kinase 2 5610 P19525 IP; LC-MS/MS
Huttlin EL , et al. 2015
EP300 E1A binding protein p300 2033 Q9Y6B2 IP/WB; in vitro acetylation assay
Zocchi L and Sassone-Corsi P 2012
ESF1 ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) 51575 Q9H501 IP; LC-MS/MS
Huttlin EL , et al. 2015
ESR1 estrogen receptor 1 2099 P03372 ChIP
Rasti M , et al. 2011
FCF1 FCF1 small subunit (SSU) processome component homolog (S. cerevisiae) 51077 Q4FZ45 IP; LC-MS/MS
Huttlin EL , et al. 2015
FHIT fragile histidine triad gene 2272 P49789 ChIP
Lin RK , et al. 2006
FHL1 four and a half LIM domains 1 2273 Q13642 ChIP
Ballestar E , et al. 2004
FMR1 fragile X mental retardation 1 2332 G8JLE9 PAR-CLIP; RNA immunoprecipitation (RIP)
Ascano M Jr , et al. 2012
FOXG1 forkhead box G1 2290 P55316 IP/WB
Dastidar SG , et al. 2012
Frg1 FSHD region gene 1 14300 P97376 RNA immunoprecipitation (RIP)
Long SW , et al. 2010
FUS fused in sarcoma 2521 P35637 in vivo splicing assay; Co-localization
Coady TH and Manley JL 2015
FXR2 Fragile X retardation 2 9513 P51116 IP; LC-MS/MS
Huttlin EL , et al. 2015
GABRB3 gamma-aminobutyric acid (GABA) A receptor, beta 3 2562 P28472 ChIP
Hogart A , et al. 2007
GAD1 glutamate decarboxylase 1 (brain, 67kDa) 2571 Q8IVA8 ChIP; Methylated DNA immunoprecipitation (MeDIP)
Zhubi A , et al. 2014
GAD2 Glutamate decarboxylase 2 2572 Q05329 ChIP; Methylated DNA immunoprecipitation (MeDIP)
Zhubi A , et al. 2014
GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 2782 P62873 ChIP
Gibson JH , et al. 2010
GNL2 guanine nucleotide binding protein-like 2 (nucleolar) 29889 Q13823 IP; LC-MS/MS
Huttlin EL , et al. 2015
GSTP1 glutathione S-transferase pi 1 2950 P09211 ChIP
Stirzaker C , et al. 2004
GTF2B general transcription factor IIB 2959 Q00403 GST
Kaludov NK and Wolffe AP 2000
GTF2F2 general transcription factor IIF, polypeptide 2, 30kDa 2963 P13984 ChIP-chip
Yasui DH , et al. 2007
GTPBP10 GTP-binding protein 10 (putative) 85865 A4D1E9 IP; LC-MS/MS
Huttlin EL , et al. 2015
GTPBP4 GTP binding protein 4 23560 D2CFK9 IP; LC-MS/MS
Huttlin EL , et al. 2015
H19 H19 fetal liver mRNA 14955 N/A Luciferase reporter assay
Drewell RA , et al. 2002
HDAC1 histone deacetylase 1 3065 Q13547 IP/WB; GST
Nan X , et al. 1998
HDAC2 histone deacetylase 2 3066 Q92769 GST
Nan X , et al. 1998
HIPK2 homeodomain interacting protein kinase 2 28996 Q9H2X6 Y2H; IP/WB; in vitro kinase assay
Bracaglia G , et al. 2009
HIRA HIR histone cell cycle regulation defective homolog A (S. cerevisiae) 7290 P54198 IP; LC-MS/MS
Huttlin EL , et al. 2015
HIST1H1T Histone H1t 3010 P22492 IP; LC-MS/MS
Huttlin EL , et al. 2015
HIST2H2BF histone cluster 2, H2bf 440689 Q5QNW6 IP; LC-MS/MS
Huttlin EL , et al. 2015
HMGN1 high mobility group nucleosome binding domain 1 3150 P05114 ChIP
Abuhatzira L , et al. 2011
HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 3178 P09651 ChIP-chip
Yasui DH , et al. 2007
HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 3178 P09651 IP; LC-MS/MS
Tsujimura K , et al. 2015
HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 3181 P22626 ChIP-chip
Yasui DH , et al. 2007
HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 220988 P51991 IP; LC-MS/MS
Tsujimura K , et al. 2015
HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 3183 P07910 IP; LC-MS/MS
Tsujimura K , et al. 2015
HNRNPF eterogeneous nuclear ribonucleoprotein F 3185 P52597 UV-cross-linking assay; EMSA
Newnham CM , et al. 2010
HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 (H) 3187 P31943 IP; LC-MS/MS
Tsujimura K , et al. 2015
HNRNPK heterogeneous nuclear ribonucleoprotein K 3190 P61978 IP; LC-MS/MS
Tsujimura K , et al. 2015
HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog 3265 P01112 ChIP-chip
Yasui DH , et al. 2007
HSPB1 heat shock 27kDa protein 1 3315 P04792 Luciferase reporter assay; ChIP
Leoh LS , et al. 2012
ID1 inhibitor of DNA binding 1, dominant negative helix-loop-helix protein 3397 P41134 ChIP
Peddada S , et al. 2006
ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein 3398 Q02363 ChIP
Peddada S , et al. 2006
ID3 inhibitor of DNA binding 3, dominant negative helix-loop-helix protein 3399 Q02535 ChIP
Peddada S , et al. 2006
ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 3400 P47928 ChIP
Peddada S , et al. 2006
IGF2 insulin-like growth factor 2 (somatomedin A) 3481 P01344 ChIP
Ballestar E , et al. 2003
IGFBP2 insulin-like growth factor binding protein 2, 36kDa 3485 P18065 ChIP
Ballestar E , et al. 2004
IL6 interleukin 6 (interferon, beta 2) 3569 B4DVM1 ChIP
Dandrea M , et al. 2009
ITGB3BP integrin beta 3 binding protein (beta3-endonexin) 23421 Q13352 IP; LC-MS/MS
Huttlin EL , et al. 2015
JMJD1C jumonji domain containing 1C 221037 Q15652 IP/WB
Sez MA , et al. 2015
JUNB jun B proto-oncogene 3726 P17275 ChIP
Yasui DH , et al. 2007
KHSRP KH-type splicing regulatory protein 8570 Q92945 ChIP-chip
Yasui DH , et al. 2007
KIF25-AS1 KIF25 antisense RNA 1 100505879 Q9Y6Z4 ChIP
Artuso R , et al. 2011
KPNA3 karyopherin alpha 3 (importin alpha 4) 3839 O00505 IP; LC-MS/MS
Huttlin EL , et al. 2015
KPNA3 karyopherin alpha 3 (importin alpha 4) 3839 O00505 IP; LC-MS/MS; IP/WB; in vitro binding assay
Baker SA , et al. 2015
KPNA4 karyopherin alpha 4 (importin alpha 3) 3840 O00629 IP; LC-MS/MS
Huttlin EL , et al. 2015
KPNA4 karyopherin alpha 4 (importin alpha 3) 3840 O00629 IP; LC-MS/MS; IP/WB; in vitro binding assay
Baker SA , et al. 2015
KPNB1 karyopherin (importin) beta 1 3837 Q14974 ChIP-chip
Yasui DH , et al. 2007
LBR lamin B receptor 3930 Q14739 IP/WB
Guarda A , et al. 2009
LENG8 leukocyte receptor cluster (LRC) member 8 114823 Q96PV6 IP; LC-MS/MS
Huttlin EL , et al. 2015
LOC407840 oviduct protein p20 407840 Q6Q2J3 Far Western Blot
Carro S , et al. 2004
MAGEA1 melanoma antigen family A, 1 (directs expression of antigen MZ2-E) 4100 P43355 ChIP
Wischnewski F , et al. 2007
MAGEA2 melanoma antigen family A, 2 4101 P43356 ChIP
Wischnewski F , et al. 2007
MAGEA3 melanoma antigen family A, 3 4102 P43357 ChIP
Wischnewski F , et al. 2007
MEF2C myocyte enhancer factor 2C 4208 Q06413 Reporter assay
Zweier M , et al. 2010
METAP2 methionyl aminopeptidase 2 10988 P50579 IP; LC-MS/MS
Huttlin EL , et al. 2015
MGMT O-6-methylguanine-DNA methyltransferase 4255 P16455 ChIP
Danam RP , et al. 2005
MINA MYC induced nuclear antigen 84864 Q8IUF8 IP; LC-MS/MS
Huttlin EL , et al. 2015
miR-432 microRNA 432 574451 N/A Luciferase reporter assay; IP/WB
Das E and Bhattacharyya NP 2014
MIR132 microRNA 132 406921 N/A Luciferase reporter assay
Alvarez-Saavedra M , et al. 2010
MIR152 microRNA 152 406943 N/A ChIP
Ji W , et al. 2012
MKI67 antigen identified by monoclonal antibody Ki-67 4288 P46013 IP; LC-MS/MS
Huttlin EL , et al. 2015
MLH1 mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) 4292 P40692 ChIP
Xiong Y , et al. 2006
MPP1 membrane protein, palmitoylated 1, 55kDa 4354 Q96Q89 ChIP
Ballestar E , et al. 2004
MT1A metallothionein 1A 4489 P04731 ChIP
Majumder S , et al. 2005
MYBBP1A MYB binding protein (P160) 1a 10514 Q9BQG0 IP; LC-MS/MS
Huttlin EL , et al. 2015
NAT10 N-acetyltransferase 10 (GCN5-related) 55226 B4DFD5 IP; LC-MS/MS
Huttlin EL , et al. 2015
NCOR1 nuclear receptor corepressor 1 9611 O75376 GST
Kokura K , et al. 2001
NEMF nuclear export mediator factor 9147 O60524 IP/WB; GST
Long SW , et al. 2010
NET1 neuroepithelial cell transforming 1 10276 Q5SQI5 ChIP
Ballestar E , et al. 2004
NEUROG1 neurogenin 1 4762 F1T0H3 ChIP
Shu L , et al. 2011
NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 84901 Q8NCF5 ChIP
Artuso R , et al. 2011
NFIC nuclear factor I/C (CCAAT-binding transcription factor) 4782 B7Z4T6 Supershift assay
Ray BK , et al. 2012
NFIX nuclear factor I/X (CCAAT-binding transcription factor) 4784 Q14938 Supershift assay
Ray BK , et al. 2012
NFY Nuclear transcription factor Y subunit alpha 4800 P23511 ChIP-Seq
Vitezic M , et al. 2014
NLE1 notchless homolog 1 (Drosophila) 54475 Q9NVX2 IP; LC-MS/MS
Huttlin EL , et al. 2015
NOC2L nucleolar complex associated 2 homolog (S. cerevisiae) 26155 Q9Y3T9 IP; LC-MS/MS
Huttlin EL , et al. 2015
NOL6 nucleolar protein 6 (RNA-associated) 65083 Q9H6R4 IP; LC-MS/MS
Huttlin EL , et al. 2015
NOL8 nucleolar protein 8 55035 A6H8Z4 IP; LC-MS/MS
Huttlin EL , et al. 2015
NOP16 NOP16 nucleolar protein 51491 Q6PIM0 IP; LC-MS/MS
Huttlin EL , et al. 2015
NOP2 NOP2 nucleolar protein 4839 P46087 IP; LC-MS/MS
Huttlin EL , et al. 2015
NOS2 nitric oxide synthase 2, inducible 4843 P35228 ChIP
Angrisano T , et al. 2012
NOS3 nitric oxide synthase 3 (endothelial cell) 4846 P60323 ChIP
Fish JE , et al. 2005
NSD1 nuclear receptor binding SET domain protein 1 64324 Q96L73 IP; LC-MS/MS
Huttlin EL , et al. 2015
NUP133 nucleoporin 133kDa 55746 Q8WUM0 ChIP-chip
Yasui DH , et al. 2007
NVL nuclear VCP-like 4931 B4DF43 IP; LC-MS/MS
Huttlin EL , et al. 2015
OR4K1 olfactory receptor, family 4, subfamily K, member 1 79544 Q8NGD4 ChIP
Artuso R , et al. 2011
OR4Q3 olfactory receptor, family 4, subfamily Q, member 3 441669 Q8NH05 ChIP
Artuso R , et al. 2011
PAM peptidylglycine alpha-amidating monooxygenase 5066 P19021 ChIP
Ballestar E , et al. 2004
PAX6 paired box 6 5080 P26367 ChIP
Ballestar E , et al. 2003
PCDHB1 protocadherin beta 1 29930 Q9Y5F3 ChIP
Miyake K , et al. 2011
PCDHB7 protocadherin beta 7 56129 Q9Y5E2 ChIP
Miyake K , et al. 2011
PDCD11 programmed cell death 11 22984 Q14690 IP; LC-MS/MS
Huttlin EL , et al. 2015
Per1 period homolog 1 (Drosophila) 18626 O35973 ChIP
Alvarez-Saavedra M , et al. 2010
Per2 period circadian clock 2 18627 O54943 ChIP
Alvarez-Saavedra M , et al. 2010
PGK1 phosphoglycerate kinase 1 5230 P00558 ChIP
Ballestar E , et al. 2004
PIKFYVE phosphoinositide kinase, FYVE finger containing 200576 Q9Y2I7 ChIP
Ballestar E , et al. 2003
PLA2G16 phospholipase A2, group XVI 11145 P53816 ChIP-chip
Yasui DH , et al. 2007
PRDX1 peroxiredoxin 1 5052 Q06830 ChIP-chip
Yasui DH , et al. 2007
PRPF3 PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae) 9129 O43395 IP/WB; GST
Long SW , et al. 2010
PRPF40B PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae) 25766 Q6NWY9 GST; ChIP
Buschdorf JP and Strtling WH 2003
PSIP1 PC4 and SFRS1 interacting protein 1 11168 O75475 Protein microarray; GST; IP/WB
Leoh LS , et al. 2012
PWP2 PWP2 periodic tryptophan protein homolog (yeast) 5822 Q15269 IP; LC-MS/MS
Huttlin EL , et al. 2015
RARB retinoic acid receptor, beta 5915 F1D8S6 ChIP
Ballestar E , et al. 2003
RASSF1 Ras association (RalGDS/AF-6) domain family member 1 11186 Q9NS23 ChIP
Ballestar E , et al. 2003
RBAK RB-associated KRAB zinc finger 57786 Q9NYW8 IP; LC-MS/MS
Huttlin EL , et al. 2015
RBM28 RNA binding motif protein 28 55131 B4DU52 IP; LC-MS/MS
Huttlin EL , et al. 2015
RELN reelin 5649 P78509 ChIP; Methylated DNA immunoprecipitation (MeDIP)
Zhubi A , et al. 2014
RET ret proto-oncogene 5979 P07949 ChIP
Gonzales ML , et al. 2012
RNASEH2A ribonuclease H2, subunit A 10535 O75792 ChIP-chip
Yasui DH , et al. 2007
RPF2 ribosome production factor 2 homolog (S. cerevisiae) 84154 Q9H7B2 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL10A ribosomal protein L10a 4736 P62906 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL12 ribosomal protein L12 6136 P30050 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL13 ribosomal protein L13 6137 A8K4C8 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL15 ribosomal protein L15 6138 P61313 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL17 ribosomal protein L17 6139 P18621 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL18 ribosomal protein L18 6141 Q07020 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL26L1 ribosomal protein L26-like 1 51121 Q9UNX3 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL27 ribosomal protein L27 6155 P61353 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL29 ribosomal protein L29 6159 P47914 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL3 ribosomal protein L3 6122 P39023 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL32 ribosomal protein L32 6161 P62910 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL36 ribosomal protein L36 25873 Q9Y3U8 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL5 ribosomal protein L5 6125 A2RUM7 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL7A ribosomal protein L7a 6130 P62424 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPL8 ribosomal protein L8 6132 P62917 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPLP2 ribosomal protein, large, P2 6181 P05387 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPP40 ribonuclease P/MRP 40kDa subunit 10799 O75818 IP; LC-MS/MS
Huttlin EL , et al. 2015
RPS8 ribosomal protein S8 6202 P62241 IP; LC-MS/MS
Huttlin EL , et al. 2015
RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 23076 Q14684 IP; LC-MS/MS
Huttlin EL , et al. 2015
RRP7A ribosomal RNA processing 7 homolog A (S. cerevisiae) 27341 Q9Y3A4 IP; LC-MS/MS
Huttlin EL , et al. 2015
RRP8 ribosomal RNA processing 8, methyltransferase, homolog (yeast) 23378 O43159 IP; LC-MS/MS
Huttlin EL , et al. 2015
SDAD1 SDA1 domain containing 1 55153 Q9NVU7 IP; LC-MS/MS
Huttlin EL , et al. 2015
SDHD succinate dehydrogenase complex, subunit D, integral membrane protein 6392 O14521 ChIP-chip
Yasui DH , et al. 2007
SIN3B SIN3 transcription regulator homolog B (yeast) 23309 O75182 IP; LC-MS/MS
Tsujimura K , et al. 2015
SIRT1 sirtuin 1 23411 A8K128 IP/WB; in vitro deacetylation assay
Zocchi L and Sassone-Corsi P 2012
SKI v-ski sarcoma viral oncogene homolog (avian) 6497 P12755 GST; IP/WB
Kokura K , et al. 2001
SLC6A2 solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 6530 P23975 ChIP
Esler M , et al. 2009
SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 6595 P51531 IP/WB
Harikrishnan KN , et al. 2005
SMARCB1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 6598 Q12824 IP/WB
Harikrishnan KN , et al. 2005
SMARCC2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 6601 Q8TAQ2 IP; LC-MS/MS
Tsujimura K , et al. 2015
SMARCD2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 6603 Q92925 IP; LC-MS/MS
Tsujimura K , et al. 2015
SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 6605 Q969G3 IP/WB
Harikrishnan KN , et al. 2005
SMC3 structural maintenance of chromosomes 3 9126 Q9UQE7 IP/WB
Gonzales ML , et al. 2012
SNURF SNRPN upstream reading frame 8926 Q9Y675 ChIP-chip
Yasui DH , et al. 2007
SP1 Sp1 transcription factor 6667 P08047 IP/WB
Koch C and Strtling WH 2004
SPNS1 spinster homolog 1 (Drosophila) 83985 Q9H2V7 ChIP
Artuso R , et al. 2011
SRBD1 S1 RNA binding domain 1 55133 Q8N5C6 IP; LC-MS/MS
Huttlin EL , et al. 2015
SRSF7 serine/arginine-rich splicing factor 7 6432 Q16629 ChIP-chip
Yasui DH , et al. 2007
SRSF8 Serine/arginine-rich splicing factor 8 10929 Q9BRL6-2 IP; LC-MS/MS
Huttlin EL , et al. 2015
STMN4 stathmin-like 4 81551 Q9H169 ChIP-chip
Yasui DH , et al. 2007
SYT3 synaptotagmin III 20981 G3X9Y1 ChIP-chip
Yasui DH , et al. 2007
TAF1A TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa 9015 A8K4K5 IP; LC-MS/MS
Huttlin EL , et al. 2015
TAF1B TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa 9014 Q53T94 IP; LC-MS/MS
Huttlin EL , et al. 2015
TAF1C TATA box-binding protein-associated factor RNA polymerase I subunit C 9013 Q15572-6 IP; LC-MS/MS
Huttlin EL , et al. 2015
TAF1D TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa 79101 Q9H5J8 IP; LC-MS/MS
Huttlin EL , et al. 2015
TEX10 testis expressed 10 54881 Q9NXF1 IP; LC-MS/MS
Huttlin EL , et al. 2015
TFB1M transcription factor B1, mitochondrial 51106 E5KTM5 IP; LC-MS/MS
Huttlin EL , et al. 2015
TGFB1 transforming growth factor, beta 1 7040 P01137 IP/WB; GST
Matsumura S , et al. 2009
TOP3A topoisomerase (DNA) III alpha 7156 Q13472 IP; LC-MS/MS
Huttlin EL , et al. 2015
TP53 tumor protein p53 7157 P04637 IP/WB; GST
Arabsolghar R , et al. 2012
TRIP12 thyroid hormone receptor interactor 12 9320 Q14669 IP; LC-MS/MS
Huttlin EL , et al. 2015
TRMT1L tRNA methyltransferase 1 homolog (S. cerevisiae)-like 81627 B4DXX1 IP; LC-MS/MS
Huttlin EL , et al. 2015
TRPC6 Short transient receptor potential channel 6 7225 Q9Y210 qRT-PCR; Peptide microarray; IP/WB; Immunofluorescence; Electrophysiology
Griesi-Oliveira K , et al. 2014
TSPAN4 tetraspanin 4 7106 O14817 ChIP-chip
Yasui DH , et al. 2007
TSSC1 tumor suppressing subtransferable candidate 1 7260 Q53HC9 ChIP
Artuso R , et al. 2011
TUBGCP5 tubulin, gamma complex associated protein 5 114791 E9PB12 ChIP-chip
Yasui DH , et al. 2007
UCHL1 ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) 7345 P09936 ChIP-chip
Yasui DH , et al. 2007
URB1 URB1 ribosome biogenesis 1 homolog (S. cerevisiae) 9875 O60287 IP; LC-MS/MS
Huttlin EL , et al. 2015
URB2 URB2 ribosome biogenesis 2 homolog (S. cerevisiae) 9816 Q14146 IP; LC-MS/MS
Huttlin EL , et al. 2015
VEGFA vascular endothelial growth factor A 7422 P15692 EMSA
Lapchak PH , et al. 2004
WDR36 WD repeat domain 36 134430 Q68E02 IP; LC-MS/MS
Huttlin EL , et al. 2015
WDR83OS WD repeat domain 83 opposite strand 51398 Q9Y284 ChIP-chip
Yasui DH , et al. 2007
YBX1 Y box binding protein 1 4904 P67809 IP/WB
Young JI , et al. 2005
YBX1 Y box binding protein 1 4904 P67809 IP; LC-MS/MS
Tsujimura K , et al. 2015
ZCCHC17 zinc finger, CCHC domain containing 17 51538 Q9NP64 IP; LC-MS/MS
Huttlin EL , et al. 2015
ZNF354A zinc finger protein 354A 6940 O60765 IP; LC-MS/MS
Huttlin EL , et al. 2015
ZNF483 zinc finger protein 483 158399 Q8TF39 IP; LC-MS/MS
Huttlin EL , et al. 2015
ZNF593 Zinc finger protein 593 51042 O00488 IP; LC-MS/MS
Huttlin EL , et al. 2015
ZNF800 zinc finger protein 800 168850 Q2TB10 IP; LC-MS/MS
Huttlin EL , et al. 2015
Arrdc4 arrestin domain containing 4 66412 Q8VD69 ChIP
Horike S , et al. 2004
ATRX alpha thalassemia/mental retardation syndrome X-linked homolog (human) 22589 Q61687 qRT-PCR; ChIP; Chromatin conformation capture
Kernohan KD , et al. 2014
Cacna2d3 calcium channel, voltage-dependent, alpha2/delta subunit 3 12294 Q9Z1L5 ChIP
Horike S , et al. 2004
Camk2a calcium/calmodulin-dependent protein kinase II alpha 12322 P11798 IP; LC-MS/MS
Li R , et al. 2016
Camk2b calcium/calmodulin-dependent protein kinase II, beta 12323 P28652 IP; LC-MS/MS
Li R , et al. 2016
Camk2d calcium/calmodulin-dependent protein kinase II, delta 108058 Q6PHZ2 IP; LC-MS/MS
Li R , et al. 2016
Camk2g calcium/calmodulin-dependent protein kinase II gamma 12325 Q923T9 IP; LC-MS/MS
Li R , et al. 2016
CamKII Calcium/calmodulin-dependent protein kinase type II subunit delta 108058 Q6PHZ2 M2 affinity gel assay; IP/WB; Immunohistochemistry; qRT-PCR; in vitro kinase assay
Zhou Z , et al. 2006
CamKIV Calcium/calmodulin-dependent protein kinase type IV P08414 IP/WB; ChIP; in vitro kinase assay; qRT-PCR
Tao J , et al. 2009
Cbx1 chromobox 1 12412 P83917 IP; LC-MS/MS
Li R , et al. 2016
Cbx3 chromobox 3 12417 P23198 IP; LC-MS/MS
Li R , et al. 2016
Cbx5 chromobox homolog 5 23468 P45973 IP/WB
Agarwal N , et al. 2007
Cbx5 chromobox homolog 5 23468 P45973 IP; LC-MS/MS
Li R , et al. 2016
Cdk7 cyclin-dependent kinase 7 12572 Q03147 IP; LC-MS/MS
Li R , et al. 2016
Cntn2 contactin 2 21367 Q61330 ChIP
Horike S , et al. 2004
Crh corticotropin releasing hormone 12918 Q8CIT0 ChIP
McGill BE , et al. 2006
Csnk2b casein kinase 2, beta polypeptide 13001 P67871 IP; LC-MS/MS
Li R , et al. 2016
Cyc1 cytochrome c-1 66445 Q9D0M3 ChIP
Horike S , et al. 2004
Ddx1 DEAD (Asp-Glu-Ala-Asp) box polypeptide 1 104721 Q91VR5 IP; LC-MS/MS
Tsujimura K , et al. 2015
Ddx10 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 77591 Q80Y44 IP; LC-MS/MS
Tsujimura K , et al. 2015
Ddx17 DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 67040 Q501J6 IP; LC-MS/MS
Tsujimura K , et al. 2015
Ddx5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 13207 Q8BTS0 IP; LC-MS/MS; IP/WB
Tsujimura K , et al. 2015
Ddx5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 13207 Q8BTS0 IP; LC-MS/MS
Li R , et al. 2016
DGCR8 Microprocessor complex subunit DGCR8 94223 Q9EQM6 GST; IP/WB; FRET
Cheng TL , et al. 2014
Dgcr8 Microprocessor complex subunit DGCR8 94223 Q9EQM6 IP/WB
Tsujimura K , et al. 2015
Dhx9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 13211 O70133 IP; LC-MS/MS; IP/WB
Li R , et al. 2016
Dlx3 distal-less homeobox 3 13393 Q64205 ChIP
Horike S , et al. 2004
Dlx4 distal-less homeobox 4 1748 Q92988 ChIP
Horike S , et al. 2004
Dmpk dystrophia myotonica-protein kinase 13400 P54265 ChIP
Horike S , et al. 2004
Dmwd dystrophia myotonica-containing WD repeat motif 13401 Q08274 ChIP
Horike S , et al. 2004
Drosha Ribonuclease 3 14000 Q5HZJ0 IP/WB
Tsujimura K , et al. 2015
Eif5b eukaryotic translation initiation factor 5B 226982 Q05D44 IP; LC-MS/MS
Li R , et al. 2016
Evc Ellis van Creveld gene syndrome 59056 P57680 ChIP
Horike S , et al. 2004
Exosc4 exosome component 4 109075 Q542B0 ChIP
Horike S , et al. 2004
Fam19a1 family with sequence similarity 19, member A1 320265 Q7TPG8 ChIP
Horike S , et al. 2004
Fam203a family with sequence similarity 203, member A 59053 Q8C3I8 ChIP
Horike S , et al. 2004
Fbxo46 F-box protein 46 243867 Q8BG80 ChIP
Horike S , et al. 2004
Foxa3 forkhead box A3 15377 P35584 ChIP
Horike S , et al. 2004
Fras1 Fraser syndrome 1 homolog (human) 231470 Q80T14 ChIP
Horike S , et al. 2004
Fus fused in sarcoma 233908 P56959 IP; LC-MS/MS; IP/WB
Li R , et al. 2016
Fut8 fucosyltransferase 8 53618 Q9WTS2 ChIP
Horike S , et al. 2004
Fxyd1 FXYD domain containing ion transport regulator 1 56188 Q9Z239 ChIP
Jordan C , et al. 2007
Gad1 glutamate decarboxylase 1 (brain, 67kDa) 14415 P48318 ChIP
Dong E , et al. 2005
Gad2 glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) 14417 P48320 ChIP
Dong E , et al. 2005
Gpaa1 GPI anchor attachment protein 1 14731 Q9WTK3 ChIP
Horike S , et al. 2004
Gria2 glutamate receptor, ionotropic, AMPA2 (alpha 2) 14800 P23819 RNA-Seq; ChIP; qRT-PCR
Li R , et al. 2016
Grina glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) 66168 Q9ESF4 ChIP
Horike S , et al. 2004
Grm2 glutamate receptor, metabotropic 2 108068 Q14BI2 ChIP
Matrisciano F , et al. 2011
Hdac1 Histone deacetylase 1 433759 O09106 IP; LC-MS/MS
Tsujimura K , et al. 2015
Hdac1 Histone deacetylase 1 433759 O09106 IP; LC-MS/MS; IP/WB
Li R , et al. 2016
Hdac2 Histone deacetylase 2 15182 P70288 IP; LC-MS/MS
Tsujimura K , et al. 2015
Hnrnpa2b1 heterogeneous nuclear ribonucleoprotein A2/B1 53379 O88569 IP; LC-MS/MS
Tsujimura K , et al. 2015
Hnrnpc heterogeneous nuclear ribonucleoprotein C 15381 Q9Z204 IP; LC-MS/MS
Tsujimura K , et al. 2015
Hnrnpc heterogeneous nuclear ribonucleoprotein C 15381 Q9Z204 IP; LC-MS/MS
Li R , et al. 2016
Hnrnpd heterogeneous nuclear ribonucleoprotein D 11991 Q60668 IP; LC-MS/MS
Tsujimura K , et al. 2015
Hnrnpf heterogeneous nuclear ribonucleoprotein F 98758 Q9Z2X1 IP; LC-MS/MS
Li R , et al. 2016
Hnrnph1 heterogeneous nuclear ribonucleoprotein H1 59013 O35737 IP; LC-MS/MS
Li R , et al. 2016
Hnrnph2 heterogeneous nuclear ribonucleoprotein H2 56258 P70333 IP; LC-MS/MS
Tsujimura K , et al. 2015
Hnrnph2 heterogeneous nuclear ribonucleoprotein H2 56258 P70333 IP; LC-MS/MS
Li R , et al. 2016
Hnrnpm heterogeneous nuclear ribonucleoprotein M 76936 Q9D0E1 IP; LC-MS/MS
Tsujimura K , et al. 2015
Hnrnpm heterogeneous nuclear ribonucleoprotein M 76936 Q9D0E1 IP; LC-MS/MS
Li R , et al. 2016
Hnrnpu heterogeneous nuclear ribonucleoprotein U 51810 Q8VEK3 IP; LC-MS/MS
Tsujimura K , et al. 2015
Hnrnpul2 heterogeneous nuclear ribonucleoprotein U-like 2 68693 Q00PI9 IP; LC-MS/MS
Li R , et al. 2016
Ifng interferon gamma 15978 P01580 ChIP
Yang T , et al. 2012
Igfbp3 insulin-like growth factor binding protein 3 24484 P15473 ChIP
Itoh M , et al. 2007
Irf2bp1 interferon regulatory factor 2 binding protein 1 272359 Q8R3Y8 ChIP
Horike S , et al. 2004
Itga3 integrin alpha 3 16400 Q62470 ChIP
Horike S , et al. 2004
Jakmip1 janus kinase and microtubule interacting protein 1 76071 Q8BVL9 ChIP
Horike S , et al. 2004
Kat7 K(lysine) acetyltransferase 7 217127 Q1AJD0 ChIP
Horike S , et al. 2004
Kirrel2 kin of IRRE like 2 (Drosophila) 243911 Q7TSU7 ChIP
Lee W , et al. 2014
Lrrc7 leucine rich repeat containing 7 242274 Q80TE7 ChIP
Horike S , et al. 2004
Maf1 MAF1 homolog (S. cerevisiae) 68877 Q9D0U6 ChIP
Horike S , et al. 2004
Matr3 matrin 3 17184 Q8K310 IP; LC-MS/MS
Li R , et al. 2016
Mbd2 methyl-CpG binding domain protein 2 17191 Q9Z2E1 IP; LC-MS/MS
Li R , et al. 2016
Mbd3 methyl-CpG binding domain protein 3 17192 Q9Z2D8 IP; LC-MS/MS
Li R , et al. 2016
Meg3 maternally expressed 3 (non-protein coding) 17263 Q8CCV7 ChIP
Jordan C , et al. 2007
miR-132 microRNA 132 387150 N/A qRT-PCR; IP/WB; Immunofluorescence
Sadegh MK , et al. 2015
miR-212 microRNA 212 387208 N/A qRT-PCR; IP/WB; Immunofluorescence
Sadegh MK , et al. 2015
Mir106a microRNA 106a 723829 N/A ChIP-chip
Wu H , et al. 2010
Mir124b microRNA 124b 387234 N/A ChIP-chip
Wu H , et al. 2010
Mir128-2 microRNA 128-2 723815 N/A ChIP-chip
Wu H , et al. 2010
Mir134 microRNA 134 387152 N/A ChIP-chip
Wu H , et al. 2010
Mir135a1 microRNA 135a-1 387153 N/A ChIP-chip
Wu H , et al. 2010
Mir137 microRNA 137 387155 N/A ChIP-chip
Wu H , et al. 2010
Mir139 microRNA 139 387157 N/A ChIP-chip
Wu H , et al. 2010
Mir142 microRNA 142 387160 N/A ChIP-chip
Wu H , et al. 2010
Mir143 microRNA 143 387161 N/A ChIP-chip
Wu H , et al. 2010
Mir145 microRNA 145 387163 N/A ChIP-chip
Wu H , et al. 2010
Mir148b microRNA 148b 724064 N/A ChIP-chip
Wu H , et al. 2010
Mir150 microRNA 150 387168 N/A ChIP-chip
Wu H , et al. 2010
Mir151 microRNA 151 387169 N/A ChIP-chip
Wu H , et al. 2010
Mir154 microRNA 154 387172 N/A ChIP-chip
Wu H , et al. 2010
Mir17 microRNA 17 723905 N/A ChIP-chip
Wu H , et al. 2010
Mir18 microRNA 18 387135 N/A ChIP-chip
Wu H , et al. 2010
Mir181c microRNA 181c 723819 N/A ChIP-chip
Wu H , et al. 2010
Mir181d microRNA 181d 100049549 N/A ChIP-chip
Wu H , et al. 2010
Mir193b microRNA 193b 100124432 N/A ChIP-chip
Wu H , et al. 2010
Mir195 microRNA 195 387190 N/A ChIP-chip
Wu H , et al. 2010
Mir19a microRNA 19a 723891 N/A ChIP-chip
Wu H , et al. 2010
Mir204 microRNA 204 387200 N/A ChIP-chip
Wu H , et al. 2010
Mir205 microRNA 205 387201 N/A ChIP-chip
Wu H , et al. 2010
Mir207 microRNA 207 387203 N/A ChIP-chip
Wu H , et al. 2010
Mir20a microRNA 20a 387139 N/A ChIP-chip
Wu H , et al. 2010
Mir211 microRNA 211 387207 N/A ChIP-chip
Wu H , et al. 2010
Mir25 microRNA 25 723926 N/A ChIP-chip
Wu H , et al. 2010
Mir28 microRNA 28 723830 N/A ChIP-chip
Wu H , et al. 2010
Mir299 microRNA 299 723927 N/A ChIP-chip
Wu H , et al. 2010
Mir300 microRNA 300 723833 N/A ChIP-chip
Wu H , et al. 2010
Mir302a microRNA 302a 723920 N/A ChIP-chip
Wu H , et al. 2010
Mir302b microRNA 302b 723948 N/A ChIP-chip
Wu H , et al. 2010
Mir302c microRNA 302c 723835 N/A ChIP-chip
Wu H , et al. 2010
Mir302d microRNA 302d 723928 N/A ChIP-chip
Wu H , et al. 2010
Mir30c-1 microRNA 30c-1 387227 N/A ChIP-chip
Wu H , et al. 2010
Mir30e microRNA 30e 723836 N/A ChIP-chip
Wu H , et al. 2010
Mir323 microRNA 323 723839 N/A ChIP-chip
Wu H , et al. 2010
Mir326 microRNA 326 723840 N/A ChIP-chip
Wu H , et al. 2010
Mir329 microRNA 329 723842 N/A ChIP-chip
Wu H , et al. 2010
Mir33 microRNA 33 723897 N/A ChIP-chip
Wu H , et al. 2010
Mir330 microRNA 330 724063 N/A ChIP-chip
Wu H , et al. 2010
Mir338 microRNA 338 723844 N/A ChIP-chip
Wu H , et al. 2010
Mir339 microRNA 339 723898 N/A ChIP-chip
Wu H , et al. 2010
Mir341 microRNA 341 723846 N/A ChIP-chip
Wu H , et al. 2010
Mir345 microRNA 345 723946 N/A ChIP-chip
Wu H , et al. 2010
Mir34b microRNA 34b 723849 N/A ChIP-chip
Wu H , et al. 2010
Mir34c microRNA 34c 723932 N/A ChIP-chip
Wu H , et al. 2010
Mir365-1 microRNA 365-1 723899 N/A ChIP-chip
Wu H , et al. 2010
Mir367 microRNA 367 723911 N/A ChIP-chip
Wu H , et al. 2010
Mir369 microRNA 369 723933 N/A ChIP-chip
Wu H , et al. 2010
Mir370 microRNA 370 723854 N/A ChIP-chip
Wu H , et al. 2010
Mir376a microRNA 376a 723855 N/A ChIP-chip
Wu H , et al. 2010
Mir376b microRNA 376b 723934 N/A ChIP-chip
Wu H , et al. 2010
Mir376c microRNA 376c 723856 N/A ChIP-chip
Wu H , et al. 2010
Mir377 microRNA 377 723857 N/A ChIP-chip
Wu H , et al. 2010
Mir378 microRNA 378 723889 N/A ChIP-chip
Wu H , et al. 2010
Mir379 microRNA 379 723858 N/A ChIP-chip
Wu H , et al. 2010
Mir380 microRNA 380 723859 N/A ChIP-chip
Wu H , et al. 2010
Mir381 microRNA 381 723935 N/A ChIP-chip
Wu H , et al. 2010
Mir382 microRNA 382 723912 N/A ChIP-chip
Wu H , et al. 2010
Mir409 microRNA 409 723862 N/A ChIP-chip
Wu H , et al. 2010
Mir410 microRNA 410 723863 N/A ChIP-chip
Wu H , et al. 2010
Mir411 microRNA 411 723936 N/A ChIP-chip
Wu H , et al. 2010
Mir412 microRNA 412 723913 N/A ChIP-chip
Wu H , et al. 2010
Mir449a microRNA 449a 723868 N/A ChIP-chip
Wu H , et al. 2010
Mir449b microRNA 449b 100190765 N/A ChIP-chip
Wu H , et al. 2010
Mir453 microRNA 453 100124484 N/A ChIP-chip
Wu H , et al. 2010
Mir485 microRNA 485 723875 N/A ChIP-chip
Wu H , et al. 2010
Mir487b microRNA 487b 723940 N/A ChIP-chip
Wu H , et al. 2010
Mir488 microRNA 488 735253 N/A ChIP-chip
Wu H , et al. 2010
Mir494 microRNA 494 723878 N/A ChIP-chip
Wu H , et al. 2010
Mir495 microRNA 495 751522 N/A ChIP-chip
Wu H , et al. 2010
Mir496 microRNA 496 751524 N/A ChIP-chip
Wu H , et al. 2010
Mir497 microRNA 497 751537 N/A ChIP-chip
Wu H , et al. 2010
Mir539 microRNA 539 723917 N/A ChIP-chip
Wu H , et al. 2010
Mir541 microRNA 541 723941 N/A ChIP-chip
Wu H , et al. 2010
Mir543 microRNA 543 723881 N/A ChIP-chip
Wu H , et al. 2010
Mir544 microRNA 544 100124450 N/A ChIP-chip
Wu H , et al. 2010
Mir654 microRNA 654 100124453 N/A ChIP-chip
Wu H , et al. 2010
Mir666 microRNA 666 751521 N/A ChIP-chip
Wu H , et al. 2010
Mir671 microRNA 671 735264 N/A ChIP-chip
Wu H , et al. 2010
Mir7-1 microRNA 7-1 723902 N/A ChIP-chip
Wu H , et al. 2010
Mir708 microRNA 708 735284 N/A ChIP-chip
Wu H , et al. 2010
Mir758 microRNA 758 791071 N/A ChIP-chip
Wu H , et al. 2010
Mir802 microRNA 802 791074 N/A ChIP-chip
Wu H , et al. 2010
Mir882 microRNA 882 100124461 N/A ChIP-chip
Wu H , et al. 2010
Mir9-1 microRNA 9-1 387133 N/A ChIP-chip
Wu H , et al. 2010
Mir93 microRNA 93 723885 N/A ChIP-chip
Wu H , et al. 2010
Mrpl1 mitochondrial ribosomal protein L1 94061 Q9D3F3 ChIP
Horike S , et al. 2004
Mug1 murinoglobulin 1 17836 P28665 ChIP
Horike S , et al. 2004
Mug2 murinoglobulin 2 17837 P28666 ChIP
Horike S , et al. 2004
Myo3a myosin IIIA 667663 F6QNG5 ChIP
Horike S , et al. 2004
Mypop Myb-related transcription factor, partner of profilin 232934 Q8R4U1 ChIP
Horike S , et al. 2004
Nanos2 nanos homolog 2 (Drosophila) 378430 I6ZHM2 ChIP
Horike S , et al. 2004
Nfasc neurofascin 269116 E9PW06 ChIP
Horike S , et al. 2004
Nfkbiz nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta 80859 Q9EST8 ChIP
Horike S , et al. 2004
NFY Nuclear transcription factor Y subunit alpha 18044 P23708 ChIP-Seq
Vitezic M , et al. 2014
Ngfr nerve growth factor receptor (TNFR superfamily, member 16) 18053 Q8CFT3 ChIP
Horike S , et al. 2004
Nnmt nicotinamide N-methyltransferase 18113 O55239 ChIP
Horike S , et al. 2004
Npm1 nucleophosmin 1 18148 Q61937 IP; LC-MS/MS
Li R , et al. 2016
Nrxn3 neurexin III 18191 Q6P9K9 ChIP
Horike S , et al. 2004
Olr1 oxidized low density lipoprotein (lectin-like) receptor 1 108078 Q9EQ09 ChIP
Horike S , et al. 2004
Oplah 5-oxoprolinase (ATP-hydrolysing) 75475 Q8K010 ChIP
Horike S , et al. 2004
Oprm1 opioid receptor, mu 1 18390 P42866 ChIP
Hwang CK , et al. 2007
Pax5 paired box gene 5 18507 Q02650 ChIP
Horike S , et al. 2004
Pcdh20 protocadherin 20 219257 Q8BIZ0 ChIP
Lee W , et al. 2014
Peg10 paternally expressed 10 170676 Q7TN75 ChIP
Horike S , et al. 2004
Phb prohibitin 18673 P67778 ChIP
Horike S , et al. 2004
Plec1 plectin 18810 E9QN87 ChIP
Horike S , et al. 2004
Pomc "NPP" 18976 P01193 qRT-PCR; ChIP; Chromatin conformation capture
Torres-Andrade R , et al. 2014
Ppp1r9a protein phosphatase 1, regulatory (inhibitor) subunit 9A 243725 Q7TN74 ChIP
Horike S , et al. 2004
Prmt6 protein arginine N-methyltransferase 6 99890 Q6NZB1 IP/WB
Dhawan S , et al. 2011
Prpf19 pre-mRNA processing factor 19 28000 Q99KP6 IP; LC-MS/MS
Li R , et al. 2016
Prpf40a PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) 56194 Q9R1C7 Far Western Blot
Bedford MT , et al. 1997
Psip1 PC4 and SFRS1 interacting protein 1 101739 Q99JF8 IP; LC-MS/MS; IP/WB
Li R , et al. 2016
Pura purine rich element binding protein A 19290 P42669 IP; LC-MS/MS
Li R , et al. 2016
Rbbp4 retinoblastoma binding protein 4 19646 Q60972 IP; LC-MS/MS
Li R , et al. 2016
Rbbp5 retinoblastoma binding protein 5 213464 Q8BX09 ChIP
Horike S , et al. 2004
Rbmx RNA binding motif protein, X chromosome 19655 Q9WV02 IP; LC-MS/MS
Tsujimura K , et al. 2015
Reln reelin 19699 Q60841 ChIP
Jordan C , et al. 2007
Rsph6a radial spoke head 6 homolog A (Chlamydomonas) 83434 Q8CDR2 ChIP
Horike S , et al. 2004
Safb2 scaffold attachment factor B2 224902 Q80YR5 IP; LC-MS/MS
Li R , et al. 2016
Sap18 Sin3-associated polypeptide 18 20220 O55128 IP; LC-MS/MS
Li R , et al. 2016
Sgce sarcoglycan, epsilon 20392 O70258 ChIP
Horike S , et al. 2004
Six5 sine oculis-related homeobox 5 20475 P70178 ChIP
Horike S , et al. 2004
Smarca1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 93761 Q6PGB8 IP; LC-MS/MS
Tsujimura K , et al. 2015
Smarca2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 67155 Q6DIC0 IP; LC-MS/MS
Li R , et al. 2016
Smarca4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 20586 Q3TKT4 IP; LC-MS/MS
Tsujimura K , et al. 2015
Smarca4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 20586 Q3TKT4 IP; LC-MS/MS
Li R , et al. 2016
Smarcc1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 20588 P97496 IP; LC-MS/MS
Tsujimura K , et al. 2015
Smarcc2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 68094 Q6PDG5 IP; LC-MS/MS
Li R , et al. 2016
Smarcd1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 83797 Q61466 IP; LC-MS/MS
Li R , et al. 2016
Smarcd2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 83796 Q99JR8 IP; LC-MS/MS
Li R , et al. 2016
Smarcd3 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 66993 Q6P9Z1 IP; LC-MS/MS
Li R , et al. 2016
Smc1a structural maintenance of chromosomes 1A 24061 Q9CU62 IP/WB; ChIP
Kernohan KD , et al. 2010
Smc1a structural maintenance of chromosomes 1A 24061 Q9CU62 IP; LC-MS/MS
Li R , et al. 2016
Smc3 structural maintenance of chromosomes 3 13006 Q9CW03 IP; LC-MS/MS
Li R , et al. 2016
SNAT1 solute carrier family 38, member 1 105727 Q8K2P7 Immunofluorescence; qRT-PCR
Jin LW , et al. 2015
Snrpd3 small nuclear ribonucleoprotein D3 67332 P62320 IP; LC-MS/MS
Li R , et al. 2016
Snrpn small nuclear ribonucleoprotein N 20646 P63163 ChIP
Samaco RC , et al. 2004
Soat1 sterol O-acyltransferase 1 20652 Q61263 ChIP
Horike S , et al. 2004
SP1 trans-acting transcription factor 1 20683 O89090 ChIP-Seq
Vitezic M , et al. 2014
Spi1 spleen focus forming virus (SFFV) proviral integration oncogene spi1 20375 P17433 GST; IP/WB
Suzuki M , et al. 2003
Sprn shadow of prion protein 212518 Q8BWU1 ChIP
Horike S , et al. 2004
Srsf4 serine/arginine-rich splicing factor 4 57317 Q8VE97 IP; LC-MS/MS
Tsujimura K , et al. 2015
Srsf6 serine/arginine-rich splicing factor 6 67996 Q3TWW8 IP; LC-MS/MS
Tsujimura K , et al. 2015
Srsf7 serine/arginine-rich splicing factor 7 225027 Q8BL97 IP; LC-MS/MS
Tsujimura K , et al. 2015
St3gal1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 20442 P54751 ChIP
Horike S , et al. 2004
Syt13 synaptotagmin XIII 80976 Q9EQT6 ChIP
Horike S , et al. 2004
Tac4 tachykinin 4 93670 Q99N14 ChIP
Horike S , et al. 2004
Tardbp TAR DNA binding protein 230908 Q921F2 RNA immunoprecipitation (RIP); IP; MS
Sephton CF , et al. 2010
Tardbp TAR DNA binding protein 230908 Q921F2 IP; LC-MS/MS; IP/WB
Li R , et al. 2016
Tmod3 tropomodulin 3 50875 Q9JHJ0 IP; LC-MS/MS
Li R , et al. 2016
Trp53bp1 transformation related protein 53 binding protein 1 27223 P70399 IP; LC-MS/MS
Li R , et al. 2016
Trpc3 transient receptor potential cation channel, subfamily C, member 3 22065 Q9QZC1 ChIP
Li W , et al. 2012
Tsix X (inactive)-specific transcript, antisense 22097 N/A ChIP
Son J , et al. 2012
Uba1y ubiquitin-activating enzyme, Chr Y 22202 P31254 ChIP
Horike S , et al. 2004
Uqcrc1 ubiquinol-cytochrome c reductase core protein I 22273 Q9CZ13 ChIP
Kriaucionis S , et al. 2006
Vamp7 vesicle-associated membrane protein 7 20955 P70280 ChIP
Matarazzo MR , et al. 2006
Zbtb16 zinc finger and BTB domain containing 16 235320 Q3UQ17 ChIP
Horike S , et al. 2004
Acta2 smooth muscle alpha-actin 81633 B0BMT0 EMSA; ChIP
Hu B , et al. 2011
ATRX alpha thalassemia/mental retardation syndrome X-linked 246284 P70486 Y2H
Nan X , et al. 2007
Bdnf brain-derived neurotrophic factor 24225 P23363 ChIP
Chen WG , et al. 2003
Bdnf brain-derived neurotrophic factor 24225 P23363 ChIP-qPCR
Liang Z , et al. 2015
Creb1 cAMP responsive element binding protein 1 81646 P15337 IP/WB
Tai DJ , et al. 2016
Dnmt1 DNA (cytosine-5-)-methyltransferase 1 84350 Q9Z330 IP/WB
Kimura H and Shiota K 2002
FOXG1 forkhead box G1 24370 Q00939 IP/WB
Dastidar SG , et al. 2012
Gadd45b Growth arrest and DNA-damage-inducible 45 beta 299626 Q5U3Z2 qRT-PCR; MSRE assay
Kigar SL , et al. 2015
Gfap glial fibrillary acidic protein 24387 P47819 ChIP
Setoguchi H , et al. 2006
Grin2b glutamate receptor, ionotropic, N-methyl D-aspartate 2B 24410 Q00960 ChIP
Lee S , et al. 2008
H2afx H2A histone family, member X 500987 D3ZXP3 IP/WB
Thambirajah AA , et al. 2011
H3f3b H3 histone, family 3B 117056 B0BMY8 IP/WB
Thambirajah AA , et al. 2011
Hmgb1 high-mobility group box 1 25459 P63159 GST
Dintilhac A and Bernus J 2001
Nfkbia nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha 18035 Q9Z1E3 XChIP
Mann J , et al. 2006
NLGN1 neuroligin 1 116647 Q62765 IP/WB; ChIP; Fluorescence Polarization (FP)
Bie B , et al. 2014
Pdyn prodynorphin 29190 F1M7S3 ChIP
Reed B , et al. 2012
Pias1 protein inhibitor of activated STAT, 1 300772 G3V9T0 in vitro SUMOylation assay; IP/WB; in vivo SUMOylation assay; Co-localization
Tai DJ , et al. 2016
Pparg peroxisome proliferator-activated receptor gamma 25664 O88275 ChIP
Mann J , et al. 2009
Rbpj recombination signal binding protein for immunoglobulin kappa J region 679028 N/A IP/WB
Mann J , et al. 2006
Rcor1 REST corepressor 1 314458 P49743 IP/WB
Lunyak VV , et al. 2002
Sin3a SIN3 homolog A, transcription regulator (yeast) 363067 D3ZBP2 GST; IP/WB
Nan X , et al. 1998
Suv39h1 suppressor of variegation 3-9 homolog 1 (Drosophila) 302553 B1H256 IP/WB
Lunyak VV , et al. 2002
CA2 carbonic anhydrase II 396257 P07630 ChIP
Rietveld LE , et al. 2002
gs17 gastrula-specific protein 17 397898 P07733 Methylated DNA immunoprecipitation (MeDIP); Bisulfite sequencing
Bogdanovi O and Veenstra GJ 2011
hes4-a hairy and enhancer of split 4 398579 Q90Z12 Methylated DNA immunoprecipitation (MeDIP); Bisulfite sequencing
Bogdanovi O and Veenstra GJ 2011
sin3b SIN3 homolog B, transcription regulator (yeast) 100036844 A1L1H5 IP/WB
Jones PL , et al. 1998
SOX2 Transcription factor Sox-2 398000 O42569 Antibody Microarray
Bestman JE , et al. 2015
t-a T, brachyury homolog 399275 P24781 Methylated DNA immunoprecipitation (MeDIP); Bisulfite sequencing
Bogdanovi O and Veenstra GJ 2011
tcea1 transcription elongation factor A (SII), 1 594866 Q91980 Methylated DNA immunoprecipitation (MeDIP); Bisulfite sequencing
Bogdanovi O and Veenstra GJ 2011
tfcp2 transcription factor CP2 403094 Q6NZH6 Methylated DNA immunoprecipitation (MeDIP); Bisulfite sequencing
Bogdanovi O and Veenstra GJ 2011
trim33 tripartite motif containing 33 733198 Q56R14 Methylated DNA immunoprecipitation (MeDIP); Bisulfite sequencing
Bogdanovi O and Veenstra GJ 2011
id1 inhibitor of DNA binding 1 30493 Q6IQW5 ChIP
Gao H , et al. 2015

HELP
Copyright © 2017 MindSpec, Inc.