HELP     Sign In
Search

Relevance to Autism

The 3-repeat MAO-uVNTR (low-activity) allele was associated with increased severity of autism, as measured by parent and teacher reports, IQ, adaptive skills, language assessments and multiple other scoring methods (Cohen et al., 2003 & 2011) and was found to be associated with ASD in a Korean population cohort (Yoo et al., 2009). In addition, genetic association has been found between MAOA and ADHD in an Indian population cohort (Das et al., 2006).

Molecular Function

The encoded protein degrades amine neurotransmitters.

External Links

        

References

Type
Title
Type of Disorder
Associated Disorders
Author, Year
Primary
Association of autism severity with a monoamine oxidase A functional polymorphism.
ASD
Positive Association
Autism severity is associated with child and maternal MAOA genotypes.
ASD
Positive Association
Family- and population-based association studies of monoamine oxidase A and autism spectrum disorders in Korean.
ASD
Positive Association
Sexual dimorphic effect in the genetic association of monoamine oxidase A (MAOA) markers with autism spectrum disorder.
ASD
Support
Targeted Next-Generation Sequencing in Patients with Suggestive X-Linked Intellectual Disability.
ID
Support
Exome Pool-Seq in neurodevelopmental disorders.
ID
Behavioral anomalies
Support
Integrated analysis of whole-exome sequencing and transcriptome profiling in males with autism spectrum disorders.
ASD
Support
MAOA/B deletion syndrome in male siblings with severe developmental delay and sudden loss of muscle tonus.
ASD
DD
Support
Monoamine oxidase A and A/B knockout mice display autistic-like features.
Support
Deletion of MAOA and MAOB in a male patient causes severe developmental delay, intermittent hypotonia and stereotypical hand movements.
DD
Support
Exploring the biological role of postzygotic and germinal de novo mutations in ASD
ASD
Highly Cited
Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A.
ID
Highly Cited
Aggressive behavior and altered amounts of brain serotonin and norepinephrine in mice lacking MAOA.
Recent Recommendation
20 ans aprs: a second mutation in MAOA identified by targeted high-throughput sequencing in a family with altered behavior and cognition.
ASD, ID
Recent Recommendation
MAOA promoter polymorphism and attention deficit hyperactivity disorder (ADHD) in indian children.
ADHD
Recent Recommendation
MAOA, maltreatment, and gene-environment interaction predicting children's mental health: new evidence and a meta-analysis.
Recent Recommendation
New insights into Brunner syndrome and potential for targeted therapy.
Brunner syndrome

Rare

Variant ID
Variant Type
Allele Change
Residue Change
Inheritance Pattern
Inheritance Association
Family Type
Author, Year
 GEN149R001 
 copy_number_loss 
  
  
 Familial 
 Maternal 
 Multiplex 
 GEN149R002 
 copy_number_loss 
  
  
 Familial 
 Maternal 
 Multiplex 
 GEN149R003 
 missense_variant 
 c.797_798delinsTT 
 p.Cys266Phe 
 Familial 
 Maternal 
 Multi-generational 
 GEN149R004 
 stop_gained 
 c.886C>T 
 p.Gln296Ter 
 Familial 
 Maternal 
 Multi-generational 
 GEN149R005 
 frameshift_variant 
 c.749_750insT 
 p.Ser251LysfsTer2 
 Unknown 
  
 Multiplex 
 GEN149R006 
 missense_variant 
 c.133C>T 
 p.Arg45Trp 
 Familial 
 Maternal 
 Multiplex 
 GEN149R007 
 splice_site_variant 
 c.1438-2A>G 
  
 Familial 
 Maternal 
 Multiplex 
 GEN149R008 
 missense_variant 
 c.730G>A 
 p.Val244Ile 
 Familial 
 Maternal 
  
 GEN149R009 
 missense_variant 
 c.617G>A 
 p.Arg206Gln 
 Familial 
 Maternal 
 Multiplex 
 GEN149R010 
 missense_variant 
 c.815C>T 
 p.Ala272Val 
 De novo 
 NA 
 Simplex 

Common

Variant ID
Polymorphism
SNP ID
Allele Change
Residue Change
Population Origin
Population Stage
Author, Year
 GEN149C001 
 microsatellite 
  
 c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) 
  
 US 
 Discovery 
 GEN149C002 
 microsatellite 
  
 c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) 
  
 Indian 
 Discovery 
 GEN149C003 
 microsatellite 
  
 c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) 
  
 Korean 
 Replication 
 GEN149C004 
 microsatellite 
  
 c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) 
  
 ASD-CARC, US 
 Replication 
 GEN149C005 
 synonymous_variant 
 rs6323 
 c.891G>T;c.492G>T 
 p.(=) 
 194 cases meeting DSM-IV-TR criteria for autistic disorder, Asperger syndrome, and PDD-NOS; 227 controls (West Bengal origins for both) 
 Discovery 
Chromosome
CNV Locus
CNV Type
# of studies
Animal Model
X
Deletion-Duplication
 15
 
X
Duplication
 1
 
X
Deletion
 1
 
X
Deletion
 4
 
X
Deletion
 1
 
X
Deletion
 4
 
X
Deletion-Duplication
 1
 
X
Deletion
 1
 
X
Duplication
 1
 
X
Deletion
 1
 
X
Deletion-Duplication
 18
 

Model Summary

NE concentrations were increased up to twofold, and cytoarchitectural changes were observed in the somatosensory cortex. Pup behavioral alterations, including trembling, difficulty in righting, and fearfulness were reversed by the serotonin synthesis inhibitor parachlorophenylalanine. Adults manifested a distinct behavioral syndrome, including enhanced aggression in males.

References

Type
Title
Author, Year
Additional
Maladaptive defensive behaviours in monoamine oxidase A-deficient mice.
Additional
Monoamine oxidase A and A/B knockout mice display autistic-like features.
Primary
Aggressive behavior and altered amounts of brain serotonin and norepinephrine in mice lacking MAOA.

M_MAOA_2_A863T_HM

Model Type: Genetic
Model Genotype: Homozygous
Mutation: Spontaneous nonsense point mutation in the 8th exon of Maoa gene.
Allele Type: Spontaenous (Mutation)
Strain of Origin: Not Specified
Genetic Background: 129S6/SvEvTac
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MAOA_3_KO_HM

Model Type: Genetic
Model Genotype: Homozygous
Mutation: IFN-beta transgene integration mediated genomic deletion of MAOA exons 2 and 3.
Allele Type: Targeted (Deletion)
Strain of Origin: Not specified
Genetic Background: 129S6
ES Cell Line: Not specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MAOA_1_KO_HM

Model Type: Genetic
Model Genotype: Homozygous
Mutation: IFN-beta transgene integration mediated genomic deletion of MAOA exons 2 and 3.
Allele Type: Targeted (Deletion)
Strain of Origin: Not Specified
Genetic Background: C3H/HeJ
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

M_MAOA_2_A863T_HM

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Social interaction1
Decreased
Description: Decreased exploratory activity and escape behavior demonstrated by increase in latency to escape to closed arm
Exp Paradigm: Elevated t maze test
 Elevated t-maze test
 3-4 months
Fear response1
Decreased
Description: Decreased fear response towards predators as demonstrated by decrease in latency to exit chamber after introduction of object with predator urine or anaesthetized rat
Exp Paradigm: Introduction of forgein objects: object with predator urine & anaesthetized rat
 Defensive withdrawal test
 3-4 months
Anxiety1
Abnormal
Description: Abnormal defensive burying behavior demonstrated by no change in baseline values, but lower diggy of predator urine-impregnated objects
Exp Paradigm: Defensive burying test of objects impregnated with predator urine or odorless
 Defensive burying test
 3-4 months
Fear response1
Increased
Description: Increased fear response/defensive behavior indicated by reduced number of approaches towards novel object, tail-rattling response
Exp Paradigm: Novel object exploration test
 Novel object recognition test
 3-4 months
Anxiety1
 No change
 Elevated plus maze test
 3-4 months
Object recognition memory1
 No change
 Novel object recognition test
 3-4 months
Olfaction1
 No change
 Buried food test
 3-4 months
Vision1
 No change
 Cliff avoidance test
 3-4 months
Social interaction1
 No change
 Novel object recognition test
 3-4 months
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Immune response, Maternal behavior, Molecular profile, Motor phenotype, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure

M_MAOA_3_KO_HM

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Gait1
Abnormal
Description: Abnormal gait deficits indicated by increase in footslips
Exp Paradigm: Male mice: beam walking assay
 Dowel walk test
 3-4 months
Morphology and size of the corpus callosum1
Decreased
Description: Decreased corpus callosum thickness restricted to rostral portion
Exp Paradigm: Corpus callosum thickness
 Histology
 Unreported
Dendritic architecture: spine density1
Increased
Description: Increased number and total length of apical dendritic branches of pyramidal neurons in orbitofrontal cortex
Exp Paradigm: Nissl staining from photomicrographs of thickness of molecular and granular layers of cerebellum
 Histology
 Unreported
Head bobbing1
Abnormal
Description: Abnormal head bobbing behavior with fewer pokes but pokes towards the same holes of apparatus
Exp Paradigm: Male mice: holeboard paradigm
 Hole-board test
 3-4 months
Repetitive digging1
Increased
Description: Increased perseverative behaviours indicated by higher number of marbles buried and increased in digging duration and frequency
Exp Paradigm: Male mice: marble-burying assay
 Marble-burying test
 3-4 months
Touch1
Decreased
Description: Decreased tactile sensitivity indicated by increased latency to remove tape from forepaw
Exp Paradigm: Male mice: sticky tape assay
 Adhesive tape test
 3-4 months
Pain or nociception1
Decreased
Description: Decreased thermal nociception indicated by increase in latency to lick their paw
Exp Paradigm: Male mice: hot plate test
 Hot plate test
 3-4 months
Social interaction1
Decreased
Description: Decreased social interaction with reduction in duration and number of investigative approaches towards foreign counterparts
Exp Paradigm: Male mice: social investigation test
 Reciprocal social interaction test
 3-4 months
Social interaction1
Decreased
Description: Decreased social interaction indicated by decrease in frequency, overall duration of sniffing and duration of anogenital sniffing
Exp Paradigm: Male mice: social interaction test
 Reciprocal social interaction test
 3-4 months
Social interaction1
Abnormal
Description: Abnormal exploratory activity with tendency to repeat the exploration of same arms
Exp Paradigm: Male mice: exploratory response in novel t-maze test
 T-maze test
 3-4 months
Ultrasonic vocalization1
Decreased
Description: Decreased ultrasonic vocalizations with reduction in number and duration of vocalizations
Exp Paradigm: Male mice: maternal separation induced ultrasonic vocalizations
 Monitoring ultrasonic vocalizations
 P6
Spatial learning1
Decreased
Description: Decreased reversal spatial learning and lower activity in platform associated quadrant
Exp Paradigm: Male mice: water maze test
 Morris water maze test
 3-4 months
Cerebellar foliation1
 No change
 Histology
 Unreported
 Not Reported: Circadian sleep/wake cycle, Developmental profile, Emotion, Immune response, Maternal behavior, Molecular profile, Neurophysiology, Physiological parameters, Seizure

M_MAOA_1_KO_HM

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Tremor1
Increased
Description: Increased tremor/violent shaking and jumps during sleep
Exp Paradigm: General observations
 General observations
 P11-p16
Jerky movement1
Increased
Description: Increased jerky movement/trembling upon locomotion and suspension by the tail
Exp Paradigm: General observations/tail suspension test
 Tail suspension test
 P5-p10
Swimming ability1
Abnormal
Description: Abnormal swimming behavior highlighted by persistent attempts to escape
Exp Paradigm: Porsolt's swim test
 Swim test
 9 weeks
Hunched posture1
Increased
Description: Increased hunched posture
Exp Paradigm: General observations
 General observations
 P11-p16
Righting response1
Increased
Description: Increased righting time
Exp Paradigm: General observations
 General observations
 P5-p10
Walking backwards1
Increased
Description: Increased walking backwards instead of pivoting
Exp Paradigm: General observations
 General observations
 P5-p10
Motor coordination and balance1
Decreased
Description: Decreased muscle coordination demonstrated by grasping of edge with hindlimbs
Exp Paradigm: Beam-walking test
 Balance beam test
 Unreported
Neurotransmitter release1
Increased
Description: Increased concentration of the amines: serotonin, dopamine, norepinephrine in brain
Exp Paradigm: High-performance liquid chromotography analysis of whole brain homogenates
 High-performance liquid chromatography (hplc)
 0-3 months
Head shaking1
Increased
Description: Increased head nodding behavior
Exp Paradigm: General observations
 General observations
 Unreported
Touch1
Increased
Description: Increased and stronger response to pinching
Exp Paradigm: General observations
 General observations
 P5-p10
Startle response: acoustic stimulus1
Abnormal
Description: Abnormal response to moderate sound: frantic running and falling over, jumping, or digging to hide under woodshavings
Exp Paradigm: General observations
 General observations
 P11-p16
Aggression1
Increased
Description: Increased aggression indicated by propensity to bite experimenter
Exp Paradigm: General observations
 General observations
 P11-p16
Aggression1
Increased
Description: Increased aggression demonstrated by bite wounds and low latency to attack intruder
Exp Paradigm: General observation/resident-intruder test
 Resident-intruder test
 2-7 months
Mating behavior1
Abnormal
Description: Abnormal mating behavior demonstrated by disruptions by episodes of grasping
Exp Paradigm: General observations
 General observations
 8 weeks
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Neuroanatomy / ultrastructure / cytoarchitecture, Physiological parameters, Seizure


Interactor Symbol Interactor Name Interactor Organism Entrez ID Uniprot ID Interaction Type Evidence Reference
FMR1 fragile X mental retardation 1 2332 G8JLE9 PAR-CLIP
Ascano M Jr , et al. 2012
MAOB Amine oxidase [flavin-containing] B 4129 P27338 IP; LC-MS/MS
Huttlin EL , et al. 2015
SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 54471 Q7L890 IP; LC-MS/MS
Huttlin EL , et al. 2015
UBC ubiquitin C 7316 P63279 MS
Wagner SA , et al. 2011

HELP
Copyright © 2017 MindSpec, Inc.