geno logo
     HELP     Sign In

Quick Links

TOOLS
Search

Relevance to Autism

This gene has been associated with syndromic autism, where a subpopulation of individuals with a given syndrome develop autism. For example, a number of studies have shown that mutations in the ARX gene are identified with a diverse spectrum of disease that includes cognitive impairment, epilepsy and severe cortical malformations.

Molecular Function

This gene is a homeobox-containing gene expressed during development. The encoded protein is a transcription factor required for normal brain development.

External Links

        

References

Type
Title
Type of Disorder
Associated Disorders
Author, Year
Primary
The ARX story (epilepsy, mental retardation, autism, and cerebral malformations): one gene leads to many phenotypes.
ASD
Support
Autism spectrum disorder and comorbid neurodevelopmental disorders (ASD-NDDs): Clinical and genetic profile of a pediatric cohort
ASD
DD, ID
Support
Novel mutation in ARX associated with early hand preference and a mild phenotype.
DD, ID
Support
Diagnostic exome sequencing of syndromic epilepsy patients in clinical practice.
Epilepsy/seizures
Support
Exome sequencing identifies novel and known mutations in families with intellectual disability
ID
Support
Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.
ASD
Support
DD, ID, epilepsy/seizures
ASD, ADHD
Support
Genomic diagnosis for children with intellectual disability and/or developmental delay.
ID
Epilepsy/seizures
Support
Genome sequencing of 320 Chinese children with epilepsy: a clinical and molecular study
DD, epilepsy/seizures
Support
ID, epilepsy/seizures
Support
Diagnostic Targeted Resequencing in 349 Patients with Drug-Resistant Pediatric Epilepsies Identifies Causative Mutations in 30 Different Genes.
Epilepsy/seizures
Support
Confirming the contribution and genetic spectrum of de novo mutation in infantile spasms: Evidence from a Chinese cohort
Epilepsy/seizures
ASD, DD
Support
ASD, DD, epilepsy/seizures
Support
The contribution of de novo coding mutations to autism spectrum disorder
ASD
Support
Constraint and conservation of paired-type homeodomains predicts the clinical outcome of missense variants of uncertain significance
ID
ASD, epilepsy/seizures
Support
Integrating de novo and inherited variants in 42
ASD
Support
Identification of risk genes for autism spectrum disorder through copy number variation analysis in Austrian families.
ASD
Support
Neurological Diseases With Autism Spectrum Disorder: Role of ASD Risk Genes.
ASD
ID, epilepsy/seizures
Support
Genetic and Phenotype Analysis of a Chinese Cohort of Infants and Children With Epilepsy
Epilepsy/seizures
DD
Support
A regulatory path associated with X-linked intellectual disability and epilepsy links KDM5C to the polyalanine expansions in ARX.
Support
The combination of whole-exome sequencing and copy number variation sequencing enables the diagnosis of rare neurological disorders.
ASD, DD
Highly Cited
ARX, a novel Prd-class-homeobox gene highly expressed in the telencephalon, is mutated in X-linked mental retardation.
ID
Highly Cited
Mutation of ARX causes abnormal development of forebrain and testes in mice and X-linked lissencephaly with abnormal genitalia in humans.
X-linked lissencephaly with ambiguous genitalia
Highly Cited
Variable expression of mental retardation, autism, seizures, and dystonic hand movements in two families with an identical ARX gene mutation.
Highly Cited
Infantile spasms, dystonia, and other X-linked phenotypes caused by mutations in Aristaless related homeobox gene, ARX.
Recent Recommendation
ARX polyalanine expansion mutations lead to migration impediment in the rostral cortex coupled with a developmental deficit of calbindin-positive c...
Recent Recommendation
ARX: a gene for all seasons.

Rare

Variant ID
Variant Type
Allele Change
Residue Change
Inheritance Pattern
Inheritance Association
Family Type
Author, Year
 GEN017R001 
 frameshift_variant 
 c.424_455del 
 p.Ala142ArgfsTer85 
 Unknown 
  
 Simplex 
 GEN017R002 
 frameshift_variant 
 c.792del 
 p.Arg265AlafsTer60 
 Familial 
 Maternal 
 Simplex 
 GEN017R003 
 missense_variant 
 c.995G>A 
 p.Arg332His 
 Familial 
 Maternal 
 Simplex 
 GEN017R004 
 stop_gained 
 c.1117C>T 
 p.Gln373Ter 
 Familial 
 Maternal 
 Simplex 
 GEN017R005 
 frameshift_variant 
 c.1188_1189insC 
 p.Gly397ArgfsTer135 
 Unknown 
  
 Simplex 
 GEN017R006 
 frameshift_variant 
 c.1372del 
 p.Ala458ArgfsTer5 
 Unknown 
  
 Simplex 
 GEN017R007 
 missense_variant 
 c.1028T>A 
 p.Leu343Gln 
 Familial 
 Maternal 
 Multiplex 
 GEN017R008 
 missense_variant 
 c.994C>T 
 p.Arg332Cys 
  
  
  
 GEN017R009 
 frameshift_variant 
 c.790del 
 p.Arg264GlyfsTer61 
  
  
  
 GEN017R010 
 inframe_insertion 
 c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG 
 p.Gly143_Ala150dup 
  
  
  
 GEN017R011 
 missense_variant 
 c.98T>C 
 p.Leu33Pro 
 Familial 
 Maternal 
 Multi-generational 
 GEN017R012 
 inframe_insertion 
 c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG 
 p.Gly143_Ala150dup 
 Familial 
 Maternal 
 Multi-generational 
 GEN017R013 
 inframe_insertion 
 c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG 
 p.Gly143_Ala150dup 
 De novo 
  
 Simplex 
 GEN017R014 
 inframe_insertion 
 c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG 
 p.Gly143_Ala150dup 
 Familial 
 Maternal 
  
 GEN017R015 
 inframe_insertion 
 c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG 
 p.Gly143_Ala150dup 
 Familial 
 Maternal 
  
 GEN017R016 
 inframe_insertion 
 c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG 
 p.Gly143_Ala150dup 
 Familial 
 Maternal 
  
 GEN017R017 
 inframe_insertion 
 c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG 
 p.Gly143_Ala150dup 
 Familial 
 Maternal 
  
 GEN017R018 
 inframe_insertion 
 c.304insGCGGCG 
 Add 2 Alas 
 Familial 
 Maternal 
  
 GEN017R019 
 missense_variant 
 c.490A>G 
 p.Gln163Arg 
  
  
  
 GEN017R020 
 missense_variant 
 c.856G>A 
 p.Gly286Ser 
  
  
  
 GEN017R021 
 inframe_insertion 
 c.430_431insGCCGCCGCGGCAGCCGCGGCCGGG 
 p.Gly143_Ala144insGlyArgArgGlySerArgGlyArg 
  
  
  
 GEN017R022 
 inframe_insertion 
 c.430_431insGCCGCCGCGGCAGCCGCGGCCGGG 
 p.Gly143_Ala144insGlyArgArgGlySerArgGlyArg 
  
  
  
 GEN017R023 
 missense_variant 
 c.1058C>T 
 p.Pro353Leu 
  
  
  
 GEN017R024 
 copy_number_loss 
  
  
  
  
  
 GEN017R025 
 inframe_insertion 
 c.333ins21 
 Add 7 Alas 
  
  
  
 GEN017R026 
 inframe_insertion 
 c.430_431insGCCGCCGCGGCAGCCGCGGCCGGG 
 p.Gly143_Ala144insGlyArgArgGlySerArgGlyArg 
  
  
  
 GEN017R027 
 missense_variant 
 c.667A>C 
 p.Thr223Pro 
 Unknown 
  
 Simplex 
 GEN017R028 
 inframe_insertion 
 c.441_442insAGCCGCGGCCGCGGCCGCCGCGGC 
 p.Ala147_Ala148insSerArgGlyArgGlyArgArgGly 
 Familial 
 Maternal 
 Multiplex 
 GEN017R029 
 copy_number_gain 
  
  
 De novo 
  
  
 GEN017R030 
 missense_variant 
 c.835G>A 
 p.Ala279Thr 
 De novo 
  
 Simplex 
 GEN017R031 
 missense_variant 
 c.1058C>T 
 p.Pro353Leu 
 De novo 
  
  
 GEN017R032 
 frameshift_variant 
 c.1002_1007delinsTGTACCA 
 p.Phe335ValfsTer197 
 De novo 
  
  
 GEN017R033 
 missense_variant 
 c.166A>G 
 p.Ser56Gly 
 Familial 
 Maternal 
  
 GEN017R034 
 frameshift_variant 
 c.1579_1582del 
 p.Arg527AlafsTer5 
 De novo 
  
  
 GEN017R035 
 frameshift_variant 
 c.121dup 
 p.Met41AsnfsTer29 
 De novo 
  
  
 GEN017R036 
 missense_variant 
 c.202C>A 
 p.Pro68Thr 
 Familial 
 Maternal 
  
 GEN017R037 
 missense_variant 
 c.1109C>T 
 p.Ala370Val 
 Familial 
 Maternal 
 Simplex 
 GEN017R038 
 missense_variant 
 c.1112G>A 
 p.Arg371Gln 
 Familial 
 Maternal 
 Extended multiplex 
 GEN017R039 
 missense_variant 
 c.1150C>T 
 p.Arg384Cys 
 De novo 
  
 Simplex 
 GEN017R040 
 missense_variant 
 c.1469C>T 
 p.Pro490Leu 
 De novo 
  
 Simplex 
 GEN017R041 
 missense_variant 
 c.1151G>A 
 p.Arg384His 
 De novo 
  
 Simplex 
 GEN017R042 
 stop_gained 
 c.370G>T 
 p.Glu124Ter 
 Unknown 
  
  
 GEN017R043 
 frameshift_variant 
 c.1449-1_1456del 
  
 Familial 
 Maternal 
 Multiplex 
 GEN017R044 
 inframe_insertion 
 c.304ins(GCG)2 
 p.(115A2) 
 Unknown 
  
  
 GEN017R045 
 missense_variant 
 c.202C>A 
 p.Pro68Thr 
 Familial 
 Maternal 
  
 GEN017R046 
 frameshift_variant 
 c.1441_1447dup 
 p.Arg483IlefsTer51 
 De novo 
  
  
 GEN017R047 
 stop_gained 
 c.1399G>T 
 p.Gly467Ter 
 De novo 
  
  
 GEN017R048 
 synonymous_variant 
 c.591C>A 
 p.Gly197%3D 
 De novo 
  
  
 GEN017R049 
 frameshift_variant 
 c.1206del 
 p.Pro403ArgfsTer60 
 De novo 
  
 Simplex 
 GEN017R050 
 missense_variant 
 c.196G>A 
 p.Gly66Ser 
 De novo 
  
 Simplex 
 GEN017R051 
 missense_variant 
 c.989G>A 
 p.Arg330His 
 Familial 
 Maternal 
  
 GEN017R052 
 stop_gained 
 c.1621G>T 
 p.Glu541Ter 
 Familial 
 Maternal 
  
 GEN017R053 
 stop_gained 
 c.1349C>A 
 p.Ser450Ter 
 De novo 
  
  
  et al.  
 GEN017R054 
 stop_gained 
 c.1111C>T 
 p.Arg371Ter 
 De novo 
  
  
  et al.  
 GEN017R055 
 frameshift_variant 
 c.201_204del 
 p.Pro68ArgfsTer99 
 De novo 
  
  
  et al.  
 GEN017R056 
 missense_variant 
 c.1139G>A 
 p.Arg380Gln 
 De novo 
  
  
  et al.  
 GEN017R057 
 stop_gained 
 c.521C>A 
 p.Ser174Ter 
 De novo 
  
  
  et al.  
 GEN017R058 
 missense_variant 
 c.1120G>T 
 p.Val374Phe 
 De novo 
  
  
  et al.  
 GEN017R059 
 frameshift_variant 
 c.1191del 
 p.Leu398CysfsTer65 
 De novo 
  
  
  et al.  
 GEN017R060 
 missense_variant 
 c.1124G>T 
 p.Trp375Leu 
 De novo 
  
  
  et al.  
 GEN017R061 
 frameshift_variant 
 c.518dup 
 p.Ser174ValfsTer64 
 De novo 
  
  
  et al.  
 GEN017R062 
 stop_gained 
 c.487C>T 
 p.Gln163Ter 
 De novo 
  
  
  et al.  

Common

No Common Variants Available
Chromosome
CNV Locus
CNV Type
# of studies
Animal Model
X
Deletion
 1
 
X
Duplication
 2
 
X
Deletion
 2
 
X
Deletion
 4
 
X
Deletion-Duplication
 1
 
X
Deletion
 1
 
X
Duplication
 1
 
X
Duplication
 2
 
X
Deletion
 1
 
X
Deletion-Duplication
 21
 

Model Summary

Recapitulation of some of the human clinical features of X-linked lissencephaly with abnormal genitalia (XLAG) in Arx mutant mice.

References

Type
Title
Author, Year
Primary
Mutation of ARX causes abnormal development of forebrain and testes in mice and X-linked lissencephaly with abnormal genitalia in humans.
Additional
A triplet repeat expansion genetic mouse model of infantile spasms syndrome, Arx(GCG)10, with interneuronopathy, spasms in infancy, persistent se...
Additional
Arx acts as a regional key selector gene in the ventral telencephalon mainly through its transcriptional repression activity.
Additional
A new mouse model of ARX dup24 recapitulates the patients' behavioral and fine motor alterations.

M_ARX_1_KO_HE

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: Targeted disruption of exon 2 of Arx gene by inserting the lacZ gene.
Allele Type: Knockout
Strain of Origin: 129P2/OlaHsd
Genetic Background: C57BL
ES Cell Line: E14TG2a
Mutant ES Cell Line:
Model Source: Kitamura lab

M_ARX_2_KI_HM_GCGREPEAT

Model Type: Genetic
Model Genotype: Homozygous; hemizygous
Mutation: Expansion of the first polyalanine tract of amino acids 100-115 from 16 to 23 residues through the insertion of seven GCG alanine codons within ten consecutive GCG alanine codons.
Allele Type: Humanized GOF mutation
Strain of Origin: 29S7/SvEvBrd-Hprt^b-m2
Genetic Background: mixed strain N2 (25% 129S5/SvEvBrd x 75% C57BL/6J)
ES Cell Line: AB2.2
Mutant ES Cell Line:
Model Source: Noebels lab

M_ARX_3_KI_HT_GCGREPEAT

Model Type: Genetic
Model Genotype: Heterozygous
Mutation: Expansion of the first polyalanine tract of amino acids 100-115 from 16 to 23 residues through the insertion of seven GCG alanine codons within ten consecutive GCG alanine codons.
Allele Type: Humanized GOF mutation
Strain of Origin: 29S7/SvEvBrd-Hprt^b-m2
Genetic Background: mixed strain N2 (25% 129S5/SvEvBrd x 75% C57BL/6J)
ES Cell Line: AB2.2
Mutant ES Cell Line:
Model Source: Noebels lab

M_ARX_4_KO_HM

Model Type: Genetic
Model Genotype: Homozygous
Mutation: Homologous recombination mediated targeted disruption of the two first exons corresponding to the N-terminal amino acids of Arx.
Allele Type: Knockout
Strain of Origin: 129/Sv
Genetic Background: C57BL/6
ES Cell Line: Not Reported
Mutant ES Cell Line:
Model Source: Gross lab

M_ARX_5_KI_HE_428DUP24

Model Type: Genetic
Model Genotype: Hemizygous
Mutation: A targeting vector containing a partially humanized mouse exon 2 fragment (corresponding to human ARX amino-acid 79-160) carrying the human c.428_451dup24 mutation was generated and electroporated into male 129sv ES cells to obtain the targeted allele. The floxed Neo selection cassette was removed in vivo by direct breeding of the chimaeras with a CMV-Cre deleter line and the Cre transgene was segregated by a further breeding step.
Allele Type: NDD GOF mutation
Strain of Origin: Not Reported
Genetic Background: C57BL/6N*129Sv/Pas*C57BL/6J
ES Cell Line: 129/Sv
Mutant ES Cell Line:
Model Source: Herault lab

M_ARX_1_KO_HE

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Anatomical projections and connectivity1
Abnormal
Description: Elongated thalamocortical axons to the internal capsule
Exp Paradigm: Immunohistochemical analysis using antibody against neurofilament 2h3 of brain slices
 Immunohistochemistry
 E19.5
Neuronal number1
Decreased
Description: Decreased proliferation of neuroepithelial cells in neocortical ventricular zone
Exp Paradigm: Histological analyses
 Histology
 E19.5
Brain size1
Decreased
Description: Mutant mice have smaller olfactory bulb
Exp Paradigm: Macroscopical analysis; histology
 Histology
 Unreported
Anatomical projections and connectivity1
Decreased
Description: Deficiencies in the fimbria and hippocampal commissure
Exp Paradigm: Immunohistochemical analysis using antibody against neurofilament 2h3 of brain slices
 Immunohistochemistry
 E19.5
Morphology and size of the corpus callosum1
Decreased
Description: Abnormal formation of nerve fiber tracts, corpus callosum
Exp Paradigm: Immunohistochemical analysis using antibody against neurofilament 2h3 of brain slices
 Immunohistochemistry
 E19.5
Brain size1
Decreased
Description: Decreased brain size
Exp Paradigm: Macroscopical analysis
 Macroscopic analysis
 Unreported
Thalamic morphology1
Decreased
Description: Deficiency of anterio-ventro medial thalamic nuclei
Exp Paradigm: Histological analysis of serial sections of brain stained with cresyl violet
 Histology
 E19.5
Hippocampal morphology1
Decreased
Description: Partial dysgenesis of the hippocampus
Exp Paradigm: Histological analysis of serial sections of brain stained with cresyl violet
 Histology
 E19.5
Brain cytoarchitecture1
Abnormal
Description: Abnormal localization of calbindin-positive interneurons in the intermediate zone, subplate and subventricular zone of the cortical plate
Exp Paradigm: Immunohistochemical analysis using antibody against calbindin, gad1
 Immunohistochemistry
 E16.5 - p3
Neuronal number: interneurons1
Decreased
Description: Decreased expression of interneurons positive for npy in the striatum
Exp Paradigm: Npy
 Immunohistochemistry
 E18.5
Cortical thickness1
Decreased
Description: Thinner cortical plate is seen in ko mice
Exp Paradigm: Histological analyses
 Histology
 E19.5
Reproductive system development1
Decreased
Description: Mutant mice have smaller testes and seminiferous tubules of greater diameter, hypoplasia of seminal vesicle
Exp Paradigm: Macroscopical analysis; histology
 Histology
 Unreported
Mortality/lethality1
Increased
Description: Increased lethality
Exp Paradigm: General observations
 General observations
 E19.5
Protein expression level evidence1
Decreased
Description: Decreased expression of lhx9 in the thalamic eminence
Exp Paradigm: Lhx9 expression
 Immunohistochemistry
 E12.5
Protein expression level evidence1
Decreased
Description: Decreased expression of dlx1 in the ventral thalamus
Exp Paradigm: Dlx1 expression
 Immunohistochemistry
 E12.5
Protein expression: in situ protein expression1
Abnormal
Description: Abnormal expansion of titf1, a marker gene of the medial ganglionic eminence, and lhx6, towards the subventricular zone of the lateral ganglionic eminence
Exp Paradigm: Titf1 & lhx6 expression pattern
 Immunohistochemistry
 E14.5
Marker expression1
Decreased
Description: Decreased expression of leydig cell marker hsd3b1 in the interstitial region of testes
Exp Paradigm: Hsd3b1 expression
 Immunohistochemistry
 Unreported
Protein expression level evidence1
Decreased
Description: Decreased expression of wnt8b in the thalamic eminence
Exp Paradigm: Wnt8b expression
 Immunohistochemistry
 E12.5
Developmental trajectory1
 No change
 Histology
 E14.5
Brain morphology1
 No change
 Pulse-chase analysis
 E12.5-e19.5
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Motor phenotype, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_ARX_2_KI_HM_GCGREPEAT

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Spontaneous movement1
Increased
Description: Increased spontaneous spasm-like myoclonic events: high-amplitude and low-amplitude
Exp Paradigm: General observations
 General observations
 P7-p11
Neuronal number: interneurons1
Decreased
Description: Decreased number of choline acetyl transferase (chat)-expressing cells in the caudate/putamen
Exp Paradigm: Chat
 Western blot
 Unreported
Neuronal number: interneurons1
Decreased
Description: Decreased expression of npy in interneurons that are part of striatum
Exp Paradigm: Npy
 Western blot
 Unreported
Neuronal number: interneurons1
Decreased
Description: Decreased expression of calbindin in interneurons of layers i-iv of the neocortex, granule cell layer of dentate gyrus, striatum
Exp Paradigm: Clb
 Western blot
 Unreported
Seizures1
Increased
Description: Increased spontaenous electrographic seizures characterized by attenuation of background activity
Exp Paradigm: Prolonged video-electroencephalographic recordings
 Electroencephalogram (eeg)
 3-10 weeks
Pain or nociception1
Increased
Description: Increased sensitivity to heat-induced pain
Exp Paradigm: NA
 Hot plate test
 2 months
Anxiety1
Decreased
Description: Decreased subnormal anxiety levels
Exp Paradigm: Open-field test; light/dark exploration test-open field test
 Open field test
 2 months
Anxiety1
Decreased
Description: Decreased subnormal anxiety levels
Exp Paradigm: Open-field test; light/dark exploration test- light-dark exploration test
 Light-dark exploration test
 2 months
Cued or contextual fear conditioning1
Decreased
Description: Decreased conditioned fear training indicated by reduction in freezing responses post-sound cue vs. pre-sound cue
Exp Paradigm: Cued and contextual fear tasks
 Fear conditioning test
 2 months
Targeted expression1
Decreased
Description: Decreased expression of arx in the deep layers v-vi of the forebrain, hippocampal formation, and striatum
Exp Paradigm: Arx expression pattern
 Western blot
 Unreported
Mortality/lethality1
 No change
 General observations
 Unreported
Reproductive system development1
 No change
 Histology
 6 weeks
Targeted expression1
 No change
 Western blot
 Unreported
Motor coordination and balance1
 No change
 Accelerating rotarod test
 2 months
Cell proliferation: neural precursors1
 No change
 Western blot
 Unreported
Neuronal number: interneurons1
 No change
 Western blot
 Unreported
Sensorimotor gating1
 No change
 Prepulse inhibition
 2 months
 Not Reported: Circadian sleep/wake cycle, Communications, Immune response, Maternal behavior, Neurophysiology, Physiological parameters, Repetitive behavior, Social behavior

M_ARX_3_KI_HT_GCGREPEAT

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Mortality/lethality1
 No change
 General observations
 Unreported
 Not Reported: Circadian sleep/wake cycle, Communications, Emotion, Immune response, Learning & memory, Maternal behavior, Molecular profile, Motor phenotype, Neuroanatomy / ultrastructure / cytoarchitecture, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_ARX_4_KO_HM

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Neuronal migration1
Increased
Description: Increased neuron migration following a radial migration toward the basal ganglia in cells after ebf3 downregulation
Exp Paradigm: Cell migration analysis after downregulation of ebf3 using electroporation of shrna expressing plasmid
 Cell migration analysis
 E14.5
Gene expression1
Decreased
Description: Decreased expression of genes rspo3, bmper, atp7a, crabp2, lypd6, lhx8, maf, zic5, cxcr4, celsr2, cxcr7, lpar1
Exp Paradigm: Gene expression
 Gene expression microarray
 E14.5
Gene expression1
Increased
Description: Increased expression of genes nts, rspo3, bmper, rab39b, pik3ca, crym, plcxd3, rasgef1, calb2, map1b, ank3, hap1, etv1, lmo4, lmo3, magel2, lmo1, ebf3, bc052046, zc3h11a, tfrc, pcdh17, c14orf100, 2900009j20, kiaa1946
Exp Paradigm: Gene expression
 Gene expression microarray
 E14.5
Gene expression1
Decreased
Description: Decreased expression in ventral telencephalon of lhx7/8, zic5, bmper, cxcr4
Exp Paradigm: Gene expression
 In situ hybridization (ish)
 E14.5
Gene expression1
Increased
Description: Increased expression of genes ebf3, magel2, lmo1, lmo3, lmo4, and rasgef1b in medial ganglionic eminence (mge)
Exp Paradigm: Gene expression
 In situ hybridization (ish)
 E14.5
Gene expression1
Decreased
Description: Decreased expression of genes: cxcx4, cxcr7, rspo3, cmaf, atp7a
Exp Paradigm: Gene expression
 Quantitative pcr (qrt-pcr)
 E14.5
Gene expression1
Increased
Description: Increased expression of genes: ebf3, lmo1, lmo3, lmo4, map1b
Exp Paradigm: Gene expression
 Quantitative pcr (qrt-pcr)
 E14.5
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Emotion, Immune response, Learning & memory, Maternal behavior, Motor phenotype, Neurophysiology, Physiological parameters, Repetitive behavior, Seizure, Sensory, Social behavior

M_ARX_5_KI_HE_428DUP24

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Hyperactivity1
Increased
Description: Mutants show increased number of arm entries compared to controls.
Exp Paradigm: NA
 Y-maze test
 P9-3months
Grasping reflex1
Decreased
Description: Mutant mice show decreased percentage of accurate reaching and grasping compared to controls.
Exp Paradigm: NA
 Horizontal bar test
 P9-3months
General locomotor activity: ambulatory activity1
Increased
Description: Mutants travel greater total distance on the open field compared to controls.
Exp Paradigm: NA
 Open field test
 P9-3months
Motor coordination and balance1
Decreased
Description: Mutant mice show increased number of slips in the beam walking test when compared to controls.
Exp Paradigm: NA
 Beam crossing
 P9-3months
Gait1
Decreased
Description: Mutant mice were highly lateralized using either left or right paw to proceed compared to controls. mutant mice show increased duration of the stance for the right hindpaw due to increased duration of the brake for the left forepaw and of the propel for the left hindpaw and also had an increased step angel for the forelimbs, compared to controls.
Exp Paradigm: NA
 Home cage behavior
 P9-3months
Neuronal number: interneurons1
Decreased
Description: Mutants show decrease in the number of choline acetyltransferase positive interneurons compared to controls at p0.
Exp Paradigm: Chat
 Immunohistochemistry
 P0
Neuronal migration1
Decreased
Description: Mutants show a decrease in the number of calbindin positive or calretinin positive interneurons and arx positive cells in the cortical plate (cp)/subplate (sp), and in the subventricular zone/intermediate zone (svz/iz) compared to controls.
Exp Paradigm: NA
 Immunohistochemistry
 E15.5
Neuronal number: interneurons1
Decreased
Description: Mutants show decrease in the number of calbindin positive gabaergic interneurons in the cortex, striatum and amygdala but not in the hippocampus at e15.5, compared to controls.
Exp Paradigm: Clb
 Immunohistochemistry
 E15.5
Brain development1
Abnormal
Description: Mutants show upregulation of genes in interneurons that are not normally expressed in this cell-type indicating defects in interneuron development compared to controls.
Exp Paradigm: NA
 Rna sequencing
 E15.5
Neuronal number: interneurons1
Abnormal
Description: Mutants show changes in the distribution of arx+, calbindin+, calretinin+ and somatostatin+ cells in both somatosensoriel and motor cortexes, compared to controls. mutants show less cells in central parts of the cortical plate (layer iv) and more cells in either the deeper part of the cortex and/or in upper parts of the cortex, compared to controls.
Exp Paradigm: Clr, clb, arx, sst
 Immunohistochemistry
 P0, adult
Neuronal number: excitatory neurons1
Decreased
Description: Mutants show a decrease in post-mitotic neurons (tbr1) in the cortex, compared to controls.
Exp Paradigm: NA
 Immunohistochemistry
 E15.5
Miniature post synaptic current amplitude: inhibitory1
Decreased
Description: Mutants show strong decrease in light evoked ipscs amplitudes recorded at 0 mv, compared to controls.
Exp Paradigm: Mice were injected in the caudal hippocampus with adeno-associated viruses (aav) containing the channel rhodopsin gene chr2. voltage clamp mode at -70 mv (to record ampar-mediated epscs) or 0 mv (to record gabaar-mediated ipscs). hippocampo-bla monosynaptic epscs and di-synaptic ipscs were elicited by 1 msec light-stimulations.
 Whole-cell voltage clamp
 2 months
Vertical jumping or back flipping1
Increased
Description: Mutants show increased vertical activity throughout the light-dark cycle compared to controls.
Exp Paradigm: NA
 Home cage behavior
 P9-3months
Seizures1
Increased
Description: Mutant pups show motor spasm for more than 20 sec involving sustained flexion of all limbs, compared to controls.
Exp Paradigm: NA
 General observations
 P9
Rearing behavior1
Increased
Description: Mutants show more rears on the open field compared to controls.
Exp Paradigm: NA
 Open field test
 P9-3months
Cued or contextual fear conditioning: memory of context1
Decreased
Description: Mutants show reduced freezing in response to memory of context compared to controls.
Exp Paradigm: NA
 Fear conditioning test
 P9-3months
Gene expression1
Decreased
Description: Mutants show decreased expression of foxp1, tac1, drd1 genes compared to controls.
Exp Paradigm: NA
 Quantitative pcr (qrt-pcr)
 E15.5
Targeted expression1
Decreased
Description: Mutants show decrease in wildtype arx transcript in the forebrain (cortex, olfactory bulb, striatum and amygdala) compared to controls.
Exp Paradigm: NA
 Semi-quantitative pcr (qrt-pcr)
 E15.5
Targeted expression1
Decreased
Description: Mutants show a decrease in wildtype arx protein expression and an increase in the larger arx variant bearing the duplication mutation, compared to controls, in the forebrain.
Exp Paradigm: NA
 Western blot
 E15.5
Gene expression1
Increased
Description: Mutants show increased expression of wnt5a genes compared to controls.
Exp Paradigm: NA
 Quantitative pcr (qrt-pcr)
 E15.5
Cued or contextual fear conditioning: memory of cue1
 No change
 Fear conditioning test
 P9-3months
Gene expression1
 No change
 Quantitative pcr (qrt-pcr)
 E15.5
Cell proliferation: neural precursors1
 No change
 Immunohistochemistry
 E15.5
Neuronal number: excitatory neurons1
 No change
 Immunohistochemistry
 E15.5
Neuronal number: interneurons1
 No change
 Immunohistochemistry
 P0, adult
Apoptosis: brain cells1
 No change
 Immunohistochemistry
 Not specified
Miniature post synaptic current amplitude: excitatory1
 No change
 Whole-cell voltage clamp
 2 months
Seizure threshold1
 No change
 Observation of chemically induced seizures
 Adult
 Not Reported: Circadian sleep/wake cycle, Communications, Developmental profile, Emotion, Immune response, Maternal behavior, Physiological parameters, Sensory





Download ARX's Cytoscape file

Interactor Symbol Interactor Name Interactor Organism Entrez ID Uniprot ID Interaction Type Evidence Reference
ACTN1 actinin, alpha 1 87 P12814 Y2H; GST
Sakai Y , et al. 2011
ACTN2 actinin, alpha 2 88 P35609 Y2H
Sakai Y , et al. 2011
AES amino-terminal enhancer of split 166 Q08117 Y2H
Sakai Y , et al. 2011
CYTIP cytohesin 1 interacting protein 9595 O60759 Y2H
Sakai Y , et al. 2011
DNM2 dynamin 2 1785 P50570 Y2H
Sakai Y , et al. 2011
ISL1 ISL LIM homeobox 1 3670 P61371 ChIP; in vitro binding assay
Liu J , et al. 2011
MECP2 methyl CpG binding protein 2 (Rett syndrome) 4204 P51608 ChIP
Dhawan S , et al. 2011
NELL2 NEL-like 2 (chicken) 4753 Q99435 Y2H
Sakai Y , et al. 2011
PICK1 protein interacting with PRKCA 1 9463 Q9NRD5 Y2H; GST
Sakai Y , et al. 2011
PKM2 pyruvate kinase, muscle 5315 P14618 Y2H
Sakai Y , et al. 2011
SETD2 SET domain containing 2 29072 Q9BYW2 Y2H
Sakai Y , et al. 2011
0610010F05Rik RIKEN cDNA 0610010F05 gene 71675 Q68FF0 ChIP-qPCR
Quill ML , et al. 2011
1100001G20Rik RIKEN cDNA 1100001G20 gene 66107 Q8BTE6 ChIP-qPCR
Quill ML , et al. 2011
1300001I01Rik RIKEN cDNA 1300001I01 gene 74148 Q5SW19 ChIP-qPCR
Quill ML , et al. 2011
1700007G11Rik RIKEN cDNA 1700007G11 gene 75784 Q810M1 ChIP-qPCR
Quill ML , et al. 2011
1700018B24Rik RIKEN cDNA 1700018B24 gene 66332 N/A ChIP-qPCR
Quill ML , et al. 2011
1700019O17Rik RIKEN cDNA 1700019O17 gene 71863 Q9DA60 ChIP-qPCR
Quill ML , et al. 2011
1700020N01Rik RIKEN cDNA 1700020N01 gene 67692 N/A ChIP-qPCR
Quill ML , et al. 2011
1700034H14Rik RIKEN cDNA 1700034H14 gene 67105 Q3THX0 ChIP-qPCR
Quill ML , et al. 2011
1700123K08Rik RIKEN cDNA 1700123K08 gene 76658 Q9D991 ChIP-qPCR
Quill ML , et al. 2011
2310046O06Rik RIKEN cDNA 2310046O06 gene 78323 Q14DQ1 ChIP-qPCR
Quill ML , et al. 2011
2310057J18Rik RIKEN cDNA 2310057J18 gene 67719 Q8C6C9 ChIP-qPCR
Quill ML , et al. 2011
2410066E13Rik RIKEN cDNA 2410066E13 gene 68235 Q9CR65 ChIP-qPCR
Quill ML , et al. 2011
2610020H08Rik RIKEN cDNA 2610020H08 gene 434234 Q7TSF9 ChIP-qPCR
Quill ML , et al. 2011
2610318N02Rik RIKEN cDNA 2610318N02 gene 70458 Q80VT5 ChIP-qPCR
Quill ML , et al. 2011
2810428I15Rik RIKEN cDNA 2810428I15 gene 66462 Q9CYZ6 ChIP-qPCR
Quill ML , et al. 2011
2900092E17Rik RIKEN cDNA 2900092E17 gene 67278 Q99L02 ChIP-qPCR
Quill ML , et al. 2011
4632428N05Rik RIKEN cDNA 4632428N05 gene 74048 E9PUF5 ChIP-qPCR
Quill ML , et al. 2011
4921511H03Rik RIKEN cDNA 4921511H03 gene 70920 Q9D5W8 ChIP-qPCR
Quill ML , et al. 2011
4921539E11Rik RIKEN cDNA 4921539E11 gene 70941 Q9D5Q8 ChIP-qPCR
Quill ML , et al. 2011
4930471M23Rik RIKEN cDNA 4930471M23 gene 74919 Q8VE96 ChIP-qPCR
Quill ML , et al. 2011
4930591A17Rik RIKEN cDNA 4930591A17 gene 68175 Q9CQH6 ChIP-qPCR
Quill ML , et al. 2011
4933409G03Rik RIKEN cDNA 4933409G03 gene 227998 Q8C5U0 ChIP-qPCR
Quill ML , et al. 2011
4933411K20Rik RIKEN cDNA 4933411K20 gene 66756 Q6ZPR1 ChIP-qPCR
Quill ML , et al. 2011
5033414D02Rik RIKEN cDNA 5033414D02 gene 67759 Q9D3P8 ChIP-qPCR
Quill ML , et al. 2011
5830403L16Rik RIKEN cDNA 5830403L16 gene 240817 Q208S0 ChIP-qPCR
Quill ML , et al. 2011
6430598A04Rik RIKEN cDNA 6430598A04 gene 243300 Q6PFX7 ChIP-qPCR
Quill ML , et al. 2011
6530418L21Rik RIKEN cDNA 6530418L21 gene 109050 Q80VY2 ChIP-qPCR
Quill ML , et al. 2011
9430020K01Rik RIKEN cDNA 9430020K01 gene 240185 B7ZN02 ChIP-qPCR
Quill ML , et al. 2011
9430023L20Rik RIKEN cDNA 9430023L20 gene 68118 Q9D8Z6 ChIP-qPCR
Quill ML , et al. 2011
9930021D14Rik BRICHOS domain containing 5 319259 Q8BV89 ChIP-qPCR
Quill ML , et al. 2011
A530053G22Rik RIKEN cDNA A530053G22 gene 208079 N/A ChIP-qPCR
Quill ML , et al. 2011
A930005I04Rik RIKEN cDNA A930005I04 gene 403174 Q8BIL2 ChIP-qPCR
Quill ML , et al. 2011
Aasdhppt aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 67618 Q9CQF6 ChIP-qPCR
Quill ML , et al. 2011
Abca5 ATP-binding cassette, sub-family A (ABC1), member 5 217265 A2AEP4 ChIP-qPCR
Quill ML , et al. 2011
Abhd1 abhydrolase domain containing 1 57742 Q9QZC8 ChIP-qPCR
Quill ML , et al. 2011
Abhd11 abhydrolase domain containing 11 68758 D3YYK0 ChIP-qPCR
Quill ML , et al. 2011
Abhd12 abhydrolase domain containing 12 76192 Q99LR1 ChIP-qPCR
Quill ML , et al. 2011
Acbd4 acyl-Coenzyme A binding domain containing 4 67131 Q80X94 ChIP-qPCR
Quill ML , et al. 2011
Accn5 amiloride-sensitive cation channel 5, intestinal 58170 Q9R0Y1 ChIP-qPCR
Quill ML , et al. 2011
Ace angiotensin I converting enzyme (peptidyl-dipeptidase A) 1 11421 A2A688 ChIP-qPCR
Quill ML , et al. 2011
Acot10 acyl-CoA thioesterase 10 64833 Q32MW3 ChIP-qPCR
Quill ML , et al. 2011
Actr3 ARP3 actin-related protein 3 74117 Q3ULF7 ChIP-qPCR
Quill ML , et al. 2011
Acvrl1 activin A receptor, type II-like 1 11482 Q61288 ChIP-qPCR
Quill ML , et al. 2011
Adamts8 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8 30806 F8VQ15 ChIP-qPCR
Quill ML , et al. 2011
Adora3 adenosine A3 receptor 11542 Q497R5 ChIP-qPCR
Quill ML , et al. 2011
Aebp1 AE binding protein 1 11568 Q640N1 ChIP-qPCR
Quill ML , et al. 2011
Aen apoptosis enhancing nuclease 68048 Q9CZI9 ChIP-qPCR
Quill ML , et al. 2011
Afp alpha fetoprotein 11576 P02772 ChIP-qPCR
Quill ML , et al. 2011
Ahi1 Abelson helper integration site 1 52906 Q8K3E5 ChIP-qPCR
Quill ML , et al. 2011
AI118078 expressed sequence AI118078 244886 B1B1B2 ChIP-qPCR
Quill ML , et al. 2011
AI413582 expressed sequence AI413582 106672 Q3V2N7 ChIP-qPCR
Quill ML , et al. 2011
AI597479 expressed sequence AI597479 98404 Q922M7 ChIP-qPCR
Quill ML , et al. 2011
Aimp1 aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 13722 Q3UZG4 ChIP-qPCR
Quill ML , et al. 2011
Alad aminolevulinate, delta-, dehydratase 17025 P10518 ChIP-qPCR
Quill ML , et al. 2011
Aldh1b1 aldehyde dehydrogenase 1 family, member B1 72535 B1AWX7 ChIP-qPCR
Quill ML , et al. 2011
Aldh8a1 aldehyde dehydrogenase 8 family, member A1 237320 Q8BH00 ChIP-qPCR
Quill ML , et al. 2011
Alg2 asparagine-linked glycosylation 2 (alpha-1,3-mannosyltransferase) 56737 Q9DBE8 ChIP-qPCR
Quill ML , et al. 2011
Alk anaplastic lymphoma kinase 11682 P97793 ChIP-qPCR
Quill ML , et al. 2011
Alkbh2 alkB, alkylation repair homolog 2 (E. coli) 231642 Q6P6J4 ChIP-qPCR
Quill ML , et al. 2011
Als2cr12 amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 (human) 108812 Q8BVM7 ChIP-qPCR
Quill ML , et al. 2011
Amd1 S-adenosylmethionine decarboxylase 1 11702 P31154 ChIP-qPCR
Quill ML , et al. 2011
Ampd2 adenosine monophosphate deaminase 2 109674 Q9DBT5 ChIP-qPCR
Quill ML , et al. 2011
Ank1 ankyrin 1, erythroid 11733 Q02357 ChIP-qPCR
Quill ML , et al. 2011
Ankk1 ankyrin 1, erythroid 11733 Q02357 ChIP-qPCR
Quill ML , et al. 2011
Ankrd22 ankyrin repeat domain 22 52024 Q9D3J5 ChIP-qPCR
Quill ML , et al. 2011
Ankrd7 ankyrin repeat domain 7 75196 Q9D504 ChIP-qPCR
Quill ML , et al. 2011
Ano4 anoctamin 4 320091 D3Z1D8 ChIP-qPCR
Quill ML , et al. 2011
Anxa10 annexin A10 26359 Q9QZ10 ChIP-qPCR
Quill ML , et al. 2011
Aox4 aldehyde oxidase 4 71872 Q3TYQ9 ChIP-qPCR
Quill ML , et al. 2011
Ap2a1 adaptor protein complex AP-2, alpha 1 subunit 11771 P17426 ChIP-qPCR
Quill ML , et al. 2011
Apoa1 apolipoprotein A-I 11806 Q00623 ChIP-qPCR
Quill ML , et al. 2011
Arhgap5 Rho GTPase activating protein 5 11855 E9PYT0 ChIP-qPCR
Quill ML , et al. 2011
Arhgef38 Rho guanine nucleotide exchange factor (GEF) 38 77669 Q80VK6 ChIP-qPCR
Quill ML , et al. 2011
Arid1a AT rich interactive domain 1A (SWI-like) 93760 A2BH40 ChIP-qPCR
Quill ML , et al. 2011
Arid4b AT rich interactive domain 4B (RBP1-like) 94246 A2CG63 ChIP-qPCR
Quill ML , et al. 2011
Arid5a AT rich interactive domain 5A (MRF1-like) 214855 Q3U108 ChIP-qPCR
Quill ML , et al. 2011
Armcx2 armadillo repeat containing, X-linked 2 67416 Q6A058 ChIP-qPCR
Quill ML , et al. 2011
Arntl aryl hydrocarbon receptor nuclear translocator-like 11865 Q9WTL8 ChIP-qPCR
Quill ML , et al. 2011
As3mt arsenic (+3 oxidation state) methyltransferase 57344 Q91WU5 ChIP-qPCR
Quill ML , et al. 2011
Asl argininosuccinate lyase 109900 Q91YI0 ChIP-qPCR
Quill ML , et al. 2011
Aspdh aspartate dehydrogenase domain containing 68352 Q9DCQ2 ChIP-qPCR
Quill ML , et al. 2011
Aspm asp (abnormal spindle)-like, microcephaly associated (Drosophila) 12316 Q4G1G9 ChIP-qPCR
Quill ML , et al. 2011
Atg2b ATG2 autophagy related 2 homolog B (S. cerevisiae) 76559 Q80XK6 ChIP-qPCR
Quill ML , et al. 2011
Atg4c autophagy related 4C, cysteine peptidase 242557 Q3UYA5 ChIP-qPCR
Quill ML , et al. 2011
Atg5 autophagy related 5 11793 Q99J83 ChIP-qPCR
Quill ML , et al. 2011
Atl2 atlastin GTPase 2 56298 Q6PA06 ChIP-qPCR
Quill ML , et al. 2011
Atp13a4 ATPase type 13A4 224079 E9QPP7 ChIP-qPCR
Quill ML , et al. 2011
Atp5j ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F 11957 P97450 ChIP-qPCR
Quill ML , et al. 2011
Atp6v0e ATPase, H+ transporting, lysosomal V0 subunit E 11974 Q9CQD8 ChIP-qPCR
Quill ML , et al. 2011
Atp7a ATPase, Cu++ transporting, alpha polypeptide 11977 Q64430 Gene microarray; qRT-PCR
Colasante G , et al. 2009
Atrnl1 attractin like 1 226255 Q6A051 ChIP-qPCR
Quill ML , et al. 2011
Atrx alpha thalassemia/mental retardation syndrome X-linked homolog (human) 22589 Q61687 ChIP-qPCR
Quill ML , et al. 2011
AU040320 expressed sequence AU040320 100317 Q8K135 ChIP-qPCR
Quill ML , et al. 2011
Axdnd1 axonemal dynein light chain domain containing 1 77352 Q3UZ57 ChIP-qPCR
Quill ML , et al. 2011
axin2 axin2 12006 O88566 ChIP-qPCR
Quill ML , et al. 2011
B3gnt7 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7 227327 Q8K0J2 ChIP-qPCR
Quill ML , et al. 2011
B4galt1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 14595 P15535 ChIP-qPCR
Quill ML , et al. 2011
Bahd1 bromo adjacent homology domain containing 1 228536 Q497V6 ChIP-qPCR
Quill ML , et al. 2011
Batf basic leucine zipper transcription factor, ATF-like 53314 O35284 ChIP-qPCR
Quill ML , et al. 2011
Bbs12 Bardet-Biedl syndrome 12 (human) 241950 Q5SUD9 ChIP-qPCR
Quill ML , et al. 2011
BC003331 cDNA sequence BC003331 226499 Q4PJX1 ChIP-qPCR
Quill ML , et al. 2011
BC005537 cDNA sequence BC005537 79555 Q3TVJ4 ChIP-qPCR
Quill ML , et al. 2011
BC030476 cDNA sequence BC030476 239368 Q8K0S2 ChIP-qPCR
Quill ML , et al. 2011
BC031181 cDNA sequence BC031181 407819 Q91WE4 ChIP-qPCR
Quill ML , et al. 2011
BC094916 cDNA sequence BC094916 545384 Q504N7 ChIP-qPCR
Quill ML , et al. 2011
Bhlhb5 basic helix-loop-helix family, member e22 59058 Q8C6A8 ChIP-qPCR
Quill ML , et al. 2011
Bivm basic, immunoglobulin-like variable motif containing 246229 Q8CBX9 ChIP-qPCR
Quill ML , et al. 2011
Brd1 bromodomain containing 1 223770 A7MCW6 ChIP-qPCR
Quill ML , et al. 2011
Brd2 bromodomain containing 2 14312 B2RS09 ChIP-qPCR
Quill ML , et al. 2011
Brms1 breast cancer metastasis-suppressor 1 107392 Q547N0 ChIP-qPCR
Quill ML , et al. 2011
Brs3 bombesin-like receptor 3 12209 B1AVC6 ChIP-qPCR
Quill ML , et al. 2011
Btd biotinidase 26363 Q8CIF4 ChIP-qPCR
Quill ML , et al. 2011
Btg4 B cell translocation gene 4 56057 Q925T9 ChIP-qPCR
Quill ML , et al. 2011
Btn1a1 butyrophilin, subfamily 1, member A1 12231 Q3UM26 ChIP-qPCR
Quill ML , et al. 2011
C1ql3 C1q-like 3 227580 B0LXL6 ChIP-qPCR
Quill ML , et al. 2011
C8b complement component 8, beta polypeptide 110382 B1ASJ7 ChIP-qPCR
Quill ML , et al. 2011
Cacna2d1 calcium channel, voltage-dependent, alpha2/delta subunit 1 12293 O08532 ChIP-qPCR
Quill ML , et al. 2011
Cacng4 calcium channel, voltage-dependent, gamma subunit 4 54377 A2AAU2 ChIP-qPCR
Quill ML , et al. 2011
Cadm3 cell adhesion molecule 3 94332 Q99N28 ChIP-qPCR
Quill ML , et al. 2011
Calb2 calbindin 2 12308 Q08331 ChIP-qPCR
Quill ML , et al. 2011
Calcr calcitonin receptor 12311 Q3UUL9 ChIP-qPCR
Quill ML , et al. 2011
Caln1 calneuron 1 140904 Q542R1 ChIP-qPCR
Quill ML , et al. 2011
Calu calumenin 12321 O35887 ChIP-qPCR
Quill ML , et al. 2011
Capns1 calpain, small subunit 1 12336 O88456 ChIP-qPCR
Quill ML , et al. 2011
Car11 carbonic anhydrase 11 12348 O70354 ChIP-qPCR
Quill ML , et al. 2011
Car3 carbonic anhydrase 3 12350 P16015 ChIP-qPCR
Quill ML , et al. 2011
Casc4 cancer susceptibility candidate 4 319996 Q6P2L7 ChIP-qPCR
Quill ML , et al. 2011
Casd1 CAS1 domain containing 1 213819 Q7TN73 ChIP-qPCR
Quill ML , et al. 2011
Casq1 calsequestrin 1 12372 O09165 ChIP-qPCR
Quill ML , et al. 2011
Catsperb cation channel, sperm-associated, beta 271036 A2RTF1 ChIP-qPCR
Quill ML , et al. 2011
Cav1 caveolin 1, caveolae protein 12389 P49817 ChIP-qPCR
Quill ML , et al. 2011
Cblc Casitas B-lineage lymphoma c 80794 G3X9U0 ChIP-qPCR
Quill ML , et al. 2011
Cbx3 chromobox 3 12417 P23198 ChIP-qPCR
Quill ML , et al. 2011
Cby1 chibby homolog 1 (Drosophila) 73739 Q9D1C2 ChIP-qPCR
Quill ML , et al. 2011
Ccdc101 coiled-coil domain containing 101 75565 Q9DA08 ChIP-qPCR
Quill ML , et al. 2011
Ccdc104 coiled-coil domain containing 104 216618 Q8C6E0 ChIP-qPCR
Quill ML , et al. 2011
Ccdc106 coiled-coil domain containing 106 232821 Q3ULM0 ChIP-qPCR
Quill ML , et al. 2011
Ccdc21 coiled-coil domain containing 21 70012 A2A9K2 ChIP-qPCR
Quill ML , et al. 2011
Ccdc28a coiled-coil domain containing 28A 215814 Q3UFK1 ChIP-qPCR
Quill ML , et al. 2011
Ccdc32 coiled-coil domain containing 32 269336 Q3UHY7 ChIP-qPCR
Quill ML , et al. 2011
Ccdc60 coiled-coil domain containing 60 269693 Q8C4J0 ChIP-qPCR
Quill ML , et al. 2011
Cchcr1 coiled-coil alpha-helical rod protein 1 240084 Q3TWA2 ChIP-qPCR
Quill ML , et al. 2011
Cckbr cholecystokinin B receptor 12426 P56481 ChIP-qPCR
Quill ML , et al. 2011
Ccl2 chemokine (C-C motif) ligand 2 20296 P10148 ChIP-qPCR
Quill ML , et al. 2011
Ccr10 chemokine (C-C motif) receptor 10 12777 Q9JL21 ChIP-qPCR
Quill ML , et al. 2011
Ccrl2 chemokine (C-C motif) receptor-like 2 54199 O35457 ChIP-qPCR
Quill ML , et al. 2011
Cct6a chaperonin containing Tcp1, subunit 6a (zeta) 12466 P80317 ChIP-qPCR
Quill ML , et al. 2011
Cd177 CD177 antigen 68891 Q8R2S8 ChIP-qPCR
Quill ML , et al. 2011
Cd274 CD274 antigen 60533 Q3U472 ChIP-qPCR
Quill ML , et al. 2011
Cd2ap CD2-associated protein 12488 Q9JLQ0 ChIP-qPCR
Quill ML , et al. 2011
Cd84 CD84 antigen 12523 Q18PI6 ChIP-qPCR
Quill ML , et al. 2011
Cdh2 cadherin 2 12558 P15116 ChIP-qPCR
Quill ML , et al. 2011
Cdh5 cadherin 5 12562 P55284 ChIP-qPCR
Quill ML , et al. 2011
Cdk17 cyclin-dependent kinase 17 237459 Q8K0D0 ChIP-qPCR
Quill ML , et al. 2011
Cdkn1a cyclin-dependent kinase inhibitor 1A (P21) 12575 P39689 ChIP-qPCR
Quill ML , et al. 2011
Cdkn2aip CDKN2A interacting protein 70925 Q8BI72 ChIP-qPCR
Quill ML , et al. 2011
Cdkn2c cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) 12580 B1ASP9 ChIP-qPCR
Quill ML , et al. 2011
Cdx1 caudal type homeobox 1 12590 P18111 ChIP-qPCR
Quill ML , et al. 2011
Ceacam9 carcinoembryonic antigen-related cell adhesion molecule 9 26368 Q78T27 ChIP-qPCR
Quill ML , et al. 2011
Cenpc1 centromere protein C1 12617 P49452 ChIP-qPCR
Quill ML , et al. 2011
Cep135 centrosomal protein 135 381644 Q6P5D4 ChIP-qPCR
Quill ML , et al. 2011
Ces1g carboxylesterase 1G 12623 Q3UW56 ChIP-qPCR
Quill ML , et al. 2011
Cfh complement component factor h 12628 E9Q8I0 ChIP-qPCR
Quill ML , et al. 2011
Cggbp1 CGG triplet repeat binding protein 1 106143 A6X966 ChIP-qPCR
Quill ML , et al. 2011
Chchd6 coiled-coil-helix-coiled-coil-helix domain containing 6 66098 E9Q4M4 ChIP-qPCR
Quill ML , et al. 2011
Chga chromogranin A 12652 P26339 ChIP-qPCR
Quill ML , et al. 2011
Chmp1b charged multivesicular body protein 1B 67064 Q99LU0 ChIP-qPCR
Quill ML , et al. 2011
Chn1 chimerin (chimaerin) 1 108699 Q91V57 ChIP-qPCR
Quill ML , et al. 2011
Chrm4 cholinergic receptor, muscarinic 4 12672 P32211 ChIP-qPCR
Quill ML , et al. 2011
Chrng cholinergic receptor, nicotinic, gamma polypeptide 11449 F8VQK4 ChIP-qPCR
Quill ML , et al. 2011
Chtf18 CTF18, chromosome transmission fidelity factor 18 214901 Q8BIW9 ChIP-qPCR
Quill ML , et al. 2011
Clca6 chloride channel calcium activated 6 99663 G3X8Z1 ChIP-qPCR
Quill ML , et al. 2011
Clec1b C-type lectin domain family 1, member b 56760 Q9JL99 ChIP-qPCR
Quill ML , et al. 2011
Clec9a C-type lectin domain family 9, member a 232414 Q8BRU4 ChIP-qPCR
Quill ML , et al. 2011
Cma1 chymase 1, mast cell 17228 A4QPC5 ChIP-qPCR
Quill ML , et al. 2011
Cnn2 calponin 2 12798 Q08093 ChIP-qPCR
Quill ML , et al. 2011
Cnnm3 cyclin M3 94218 Q32NY4 ChIP-qPCR
Quill ML , et al. 2011
Cntn1 contactin 1 12805 P12960 ChIP-qPCR
Quill ML , et al. 2011
Col10a1 collagen, type X, alpha 1 12813 Q05306 ChIP-qPCR
Quill ML , et al. 2011
Col6a2 collagen, type VI, alpha 2 12834 Q02788 ChIP-qPCR
Quill ML , et al. 2011
Comtd1 catechol-O-methyltransferase domain containing 1 69156 Q8BIG7 ChIP-qPCR
Quill ML , et al. 2011
Cotl1 coactosin-like 1 (Dictyostelium) 72042 Q544F6 ChIP-qPCR
Quill ML , et al. 2011
Cox17 cytochrome c oxidase, subunit XVII assembly protein homolog (yeast) 12856 P56394 ChIP-qPCR
Quill ML , et al. 2011
Cox7a2l cytochrome c oxidase subunit VIIa polypeptide 2-like 20463 E9PZS8 ChIP-qPCR
Quill ML , et al. 2011
Cox7b2 cytochrome c oxidase subunit VIIb2 78174 Q9D2H1 ChIP-qPCR
Quill ML , et al. 2011
Cox8b cytochrome c oxidase, subunit VIIIb 12869 P48772 ChIP-qPCR
Quill ML , et al. 2011
Cpeb1 cytoplasmic polyadenylation element binding protein 1 12877 P70166 ChIP-qPCR
Quill ML , et al. 2011
Cpne2 copine II 234577 P59108 ChIP-qPCR
Quill ML , et al. 2011
Cpsf1 cleavage and polyadenylation specific factor 1 94230 Q9EPU4 ChIP-qPCR
Quill ML , et al. 2011
Crb1 crumbs homolog 1 (Drosophila) 170788 Q8VHS2 ChIP-qPCR
Quill ML , et al. 2011
Creb3l1 cAMP responsive element binding protein 3-like 1 26427 Q9Z125 ChIP-qPCR
Quill ML , et al. 2011
Crtac1 cartilage acidic protein 1 72832 Q8R555 ChIP-qPCR
Quill ML , et al. 2011
Cry2 cryptochrome 2 (photolyase-like) 12953 Q9R194 ChIP-qPCR
Quill ML , et al. 2011
Cryge crystallin, gamma E 12968 Q03740 ChIP-qPCR
Quill ML , et al. 2011
Csn1s1 casein alpha s1 12990 P19228 ChIP-qPCR
Quill ML , et al. 2011
Cst13 cystatin 13 69294 A2APW3 ChIP-qPCR
Quill ML , et al. 2011
Cst7 cystatin F (leukocystatin) 13011 O89098 ChIP-qPCR
Quill ML , et al. 2011
Cstf2t cleavage stimulation factor, 3' pre-RNA subunit 2, tau 83410 Q8C7E9 ChIP-qPCR
Quill ML , et al. 2011
Ctnna2 catenin (cadherin associated protein), alpha 2 12386 Q61301 ChIP-qPCR
Quill ML , et al. 2011
Ctr9 Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 22083 Q05CJ7 ChIP-qPCR
Quill ML , et al. 2011
Cuedc2 CUE domain containing 2 67116 Q9CXX9 ChIP-qPCR
Quill ML , et al. 2011
Cwc22 CWC22 spliceosome-associated protein homolog (S. cerevisiae) 80744 B1AYU5 ChIP-qPCR
Quill ML , et al. 2011
cwh43 cell wall biogenesis 43 C-terminal homolog (S. cerevisiae) 231293 Q91YL7 ChIP-qPCR
Quill ML , et al. 2011
Cxcl10 chemokine (C-X-C motif) ligand 10 15945 P17515 ChIP-qPCR
Quill ML , et al. 2011
Cxcl11 chemokine (C-X-C motif) ligand 11 56066 Q9JHH5 ChIP-qPCR
Quill ML , et al. 2011
Cxcr2 chemokine (C-X-C motif) receptor 2 12765 P35343 ChIP-qPCR
Quill ML , et al. 2011
Cxcr4 chemokine (C-X-C motif) receptor 4 12767 P70658 Gene microarray; qRT-PCR
Colasante G , et al. 2009
Cxcr5 chemokine (C-X-C motif) receptor 5 12145 Q04683 ChIP-qPCR
Quill ML , et al. 2011
Cxcr7 chemokine (C-X-C motif) receptor 7 12778 P56485 Gene microarray; qRT-PCR
Colasante G , et al. 2009
Cxxc4 CXXC finger 4 319478 Q6NXI8 ChIP-qPCR
Quill ML , et al. 2011
Cxxc5 CXXC finger 5 67393 Q91WA4 ChIP-qPCR
Quill ML , et al. 2011
Cyb5r4 cytochrome b5 reductase 4 266690 Q3TDX8 ChIP-qPCR
Quill ML , et al. 2011
Cybb cytochrome b-245, beta polypeptide 13058 Q3U6G0 ChIP-qPCR
Quill ML , et al. 2011
Cyp1b1 cytochrome P450, family 1, subfamily b, polypeptide 1 13078 Q64429 ChIP-qPCR
Quill ML , et al. 2011
Cyp26b1 cytochrome P450, family 26, subfamily b, polypeptide 1 232174 Q811W2 ChIP-qPCR
Quill ML , et al. 2011
Cyp2b10 cytochrome P450, family 2, subfamily b, polypeptide 10 13088 Q9WUD0 ChIP-qPCR
Quill ML , et al. 2011
Cyp2c55 cytochrome P450, family 2, subfamily c, polypeptide 55 72082 Q9D816 ChIP-qPCR
Quill ML , et al. 2011
Cyp2c66 cytochrome P450, family 2, subfamily c, polypeptide 66 69888 Q5GLZ0 ChIP-qPCR
Quill ML , et al. 2011
Cyp2r1 cytochrome P450, family 2, subfamily r, polypeptide 1 244209 Q32MW1 ChIP-qPCR
Quill ML , et al. 2011
D10Jhu81e DNA segment, Chr 10, Johns Hopkins University 81 expressed 28295 Q9D172 ChIP-qPCR
Quill ML , et al. 2011
D19Ertd737e DNA segment, Chr 19, ERATO Doi 737, expressed 76539 Q8C6C7 ChIP-qPCR
Quill ML , et al. 2011
Dbndd2 dysbindin (dystrobrevin binding protein 1) domain containing 2 52840 Q330P7 ChIP-qPCR
Quill ML , et al. 2011
Dbnl Drebrin-like 13169 Q62418 ChIP-qPCR
Quill ML , et al. 2011
Dcaf13 DDB1 and CUL4 associated factor 13 223499 Q6PAC3 ChIP-qPCR
Quill ML , et al. 2011
Dcun1d1 DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) 114893 Q9QZ73 ChIP-qPCR
Quill ML , et al. 2011
Ddit4 DNA-damage-inducible transcript 4 74747 B7ZNP9 ChIP-qPCR
Quill ML , et al. 2011
Defb2 defensin beta 2 13215 P82020 ChIP-qPCR
Quill ML , et al. 2011
Defb29 defensin beta 29 75400 A3KGR0 ChIP-qPCR
Quill ML , et al. 2011
Defb50 defensin beta 50 387334 Q6TU36 ChIP-qPCR
Quill ML , et al. 2011
Depdc6 DEP domain containing MTOR-interacting protein 97998 B2ZRS7 ChIP-qPCR
Quill ML , et al. 2011
Derl3 Der1-like domain family, member 3 70377 Q14C34 ChIP-qPCR
Quill ML , et al. 2011
Dgkz diacylglycerol kinase zeta 104418 Q80UP3 ChIP-qPCR
Quill ML , et al. 2011
Dhx37 DEAH (Asp-Glu-Ala-His) box polypeptide 37 208144 Q6NZL1 ChIP-qPCR
Quill ML , et al. 2011
Dip2b DIP2 disco-interacting protein 2 homolog B (Drosophila) 239667 Q3UH60 ChIP-qPCR
Quill ML , et al. 2011
Dmp1 dentin matrix protein 1 13406 O55188 ChIP-qPCR
Quill ML , et al. 2011
Dmrt3 doublesex and mab-3 related transcription factor 3 240590 Q80WT2 ChIP-qPCR
Quill ML , et al. 2011
Dmrta2 doublesex and mab-3 related transcription factor like family A2 242620 A2A9A2 ChIP-qPCR
Quill ML , et al. 2011
Dmrtc1a DMRT-like family C1a 70887 B1AX34 ChIP-qPCR
Quill ML , et al. 2011
Doc2b double C2, beta 13447 P70169 ChIP-qPCR
Quill ML , et al. 2011
Dok6 docking protein 6 623279 Q2MHE5 ChIP-qPCR
Quill ML , et al. 2011
Dpm2 dolichol-phosphate (beta-D) mannosyltransferase 2 13481 Q545R7 ChIP-qPCR
Quill ML , et al. 2011
Dppa3 developmental pluripotency-associated 3 73708 Q8QZY3 ChIP-qPCR
Quill ML , et al. 2011
Dpyd dihydropyrimidine dehydrogenase 99586 Q8CHR6 ChIP-qPCR
Quill ML , et al. 2011
Dpys dihydropyrimidinase 64705 Q9EQF5 ChIP-qPCR
Quill ML , et al. 2011
Drap1 Dr1 associated protein 1 (negative cofactor 2 alpha) 66556 Q4FJW2 ChIP-qPCR
Quill ML , et al. 2011
Dtx2 deltex 2 homolog (Drosophila) 74198 Q8R3P2 ChIP-qPCR
Quill ML , et al. 2011
Dusp11 dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) 72102 Q6NXK5 ChIP-qPCR
Quill ML , et al. 2011
Dusp19 dual specificity phosphatase 19 68082 Q99N12 ChIP-qPCR
Quill ML , et al. 2011
Ebf3 early B-cell factor 3 13593 O08791 Gene microarray; qRT-PCR; Luciferase reporter assay; ChIP; EMSA
Fulp CT , et al. 2008
Eda ectodysplasin-A 13607 O54693 ChIP-qPCR
Quill ML , et al. 2011
Eda2r ectodysplasin A2 receptor 245527 Q8BX35 ChIP-qPCR
Quill ML , et al. 2011
Ednra endothelin receptor type A 13617 Q61614 ChIP-qPCR
Quill ML , et al. 2011
Efcab8 EF-hand calcium binding domain 8 329541 Q8C9R9 ChIP-qPCR
Quill ML , et al. 2011
Efnb3 ephrin B3 13643 O35393 ChIP-qPCR
Quill ML , et al. 2011
Efs embryonal Fyn-associated substrate 13644 Q64355 ChIP-qPCR
Quill ML , et al. 2011
Egfl6 EGF-like-domain, multiple 6 54156 Q9JJZ5 ChIP-qPCR
Quill ML , et al. 2011
Egr1 early growth response 1 13653 P08046 ChIP-qPCR
Quill ML , et al. 2011
Eif2ak3 eukaryotic translation initiation factor 2 alpha kinase 3 13666 E9QQ30 ChIP-qPCR
Quill ML , et al. 2011
Eif4a2 eukaryotic translation initiation factor 4A2 13682 E9Q561 ChIP-qPCR
Quill ML , et al. 2011
Eif5 eukaryotic translation initiation factor 5 217869 P59325 ChIP-qPCR
Quill ML , et al. 2011
Emc7 ER membrane protein complex subunit 7 73024 Q14C26 ChIP-qPCR
Quill ML , et al. 2011
Enc1 ectodermal-neural cortex 1 13803 O35709 ChIP-qPCR
Quill ML , et al. 2011
Endog endonuclease G 13804 O08600 ChIP-qPCR
Quill ML , et al. 2011
Enpp4 ectonucleotide pyrophosphatase/phosphodiesterase 4 224794 B8JJY5 ChIP-qPCR
Quill ML , et al. 2011
Eomes eomesodermin homolog (Xenopus laevis) 13813 O54839 ChIP-qPCR
Quill ML , et al. 2011
Epb4.1l1 erythrocyte protein band 4.1-like 1 13821 Q8C8P2 ChIP-qPCR
Quill ML , et al. 2011
Epgn epithelial mitogen 71920 Q0VEB7 ChIP-qPCR
Quill ML , et al. 2011
Epha3 Eph receptor A3 13837 Q8BRB1 ChIP-qPCR
Quill ML , et al. 2011
Ephb1 Eph receptor B1 270190 Q8CA63 ChIP-qPCR
Quill ML , et al. 2011
Ephx2 epoxide hydrolase 2, cytoplasmic 13850 P34914 ChIP-qPCR
Quill ML , et al. 2011
Epyc epiphycan 13516 P70186 ChIP-qPCR
Quill ML , et al. 2011
Ermn ermin, ERM-like protein 77767 Q5EBJ4 ChIP-qPCR
Quill ML , et al. 2011
Esam1 endothelial cell-specific adhesion molecule 69524 Q3U102 ChIP-qPCR
Quill ML , et al. 2011
Espn espin 56226 Q9DD12 ChIP-qPCR
Quill ML , et al. 2011
Esx1 extraembryonic, spermatogenesis, homeobox 1 13984 O88933 ChIP-qPCR
Quill ML , et al. 2011
Esyt3 extended synaptotagmin-like protein 3 272636 Q5DTI8 ChIP-qPCR
Quill ML , et al. 2011
Ets2 E26 avian leukemia oncogene 2, 3' domain 23872 P15037 ChIP-qPCR
Quill ML , et al. 2011
Evx2 even skipped homeotic gene 2 homolog 14029 A2ASM4 ChIP-qPCR
Quill ML , et al. 2011
Exosc4 exosome component 4 109075 Q542B0 ChIP-qPCR
Quill ML , et al. 2011
Fa2h fatty acid 2-hydroxylase 338521 Q5MPP0 ChIP-qPCR
Quill ML , et al. 2011
Fam107b family with sequence similarity 107, member B 66540 Q3TGF2 ChIP-qPCR
Quill ML , et al. 2011
Fam124b family with sequence similarity 124, member B 241128 Q8BLQ0 ChIP-qPCR
Quill ML , et al. 2011
Fam160a1 family with sequence similarity 160, member A1 229488 Q505K2 ChIP-qPCR
Quill ML , et al. 2011
Fam168b family with sequence similarity 168, member B 214469 G3UWF0 ChIP-qPCR
Quill ML , et al. 2011
Fam171a2 family with sequence similarity 171, member A2 217219 A2A699 ChIP-qPCR
Quill ML , et al. 2011
Fam26f family with sequence similarity 26, member F 215900 Q8C9E8 ChIP-qPCR
Quill ML , et al. 2011
Fam45A family with sequence similarity 45, member A 67894 Q9D8N2 ChIP-qPCR
Quill ML , et al. 2011
Fam50a family with sequence similarity 50, member A 108160 Q9WV03 ChIP-qPCR
Quill ML , et al. 2011
Fam53b family with sequence similarity 53, member B 77938 Q8BGR5 ChIP-qPCR
Quill ML , et al. 2011
Fam83g family with sequence similarity 83, member G 69640 Q5SWY7 ChIP-qPCR
Quill ML , et al. 2011
Fap fibroblast activation protein 14089 A2AS87 ChIP-qPCR
Quill ML , et al. 2011
Fbf1 Fas (TNFRSF6) binding factor 1 217335 A2A870 ChIP-qPCR
Quill ML , et al. 2011
Fbxo15 F-box protein 15 50764 Q3TJW2 ChIP-qPCR
Quill ML , et al. 2011
Fbxo40 F-box protein 40 207215 P62932 ChIP-qPCR
Quill ML , et al. 2011
Fbxw4 F-box and WD-40 domain protein 4 30838 Q9JMJ2 ChIP-qPCR
Quill ML , et al. 2011
Fcamr Fc receptor, IgA, IgM, high affinity 64435 Q2TB54 ChIP-qPCR
Quill ML , et al. 2011
Fcna ficolin A 14133 O70165 ChIP-qPCR
Quill ML , et al. 2011
Fert2 fer (fms/fps related) protein kinase, testis specific 2 14158 P70451 ChIP-qPCR
Quill ML , et al. 2011
Fev FEV (ETS oncogene family) 260298 Q8QZW2 ChIP-qPCR
Quill ML , et al. 2011
Fgf20 fibroblast growth factor 20 80857 Q9ESL9 ChIP-qPCR
Quill ML , et al. 2011
Fgf4 fibroblast growth factor 4 14175 P11403 ChIP-qPCR
Quill ML , et al. 2011
Fgfbp3 fibroblast growth factor binding protein 3 72514 Q1HCM0 ChIP-qPCR
Quill ML , et al. 2011
Fgfr1op2 FGFR1 oncogene partner 2 67529 Q9CRA9 ChIP-qPCR
Quill ML , et al. 2011
Fgfr2 fibroblast growth factor receptor 2 14183 E9QK53 ChIP-qPCR
Quill ML , et al. 2011
Fgr Gardner-Rasheed feline sarcoma viral (Fgr) oncogene homolog 14191 P14234 ChIP-qPCR
Quill ML , et al. 2011
Fhad1 forkhead-associated (FHA) phosphopeptide binding domain 1 329977 A6PWD2 ChIP-qPCR
Quill ML , et al. 2011
Fhod1 formin homology 2 domain containing 1 234686 Q6P9Q4 ChIP-qPCR
Quill ML , et al. 2011
Fibcd1 fibrinogen C domain containing 1 98970 A2AV25 ChIP-qPCR
Quill ML , et al. 2011
Fignl1 fidgetin-like 1 60530 Q8BPY9 ChIP-qPCR
Quill ML , et al. 2011
Fmnl1 formin-like 1 57778 A2AB61 ChIP-qPCR
Quill ML , et al. 2011
Fnip1 folliculin interacting protein 1 216742 Q68FD7 ChIP-qPCR
Quill ML , et al. 2011
Fosb FBJ osteosarcoma oncogene B 14282 A2RSD4 ChIP-qPCR
Quill ML , et al. 2011
Foxa1 forkhead box A1 15375 P35582 ChIP-qPCR
Quill ML , et al. 2011
Foxb2 forkhead box B2 14240 B9EII5 ChIP-qPCR
Quill ML , et al. 2011
Foxf1a forkhead box F1 15227 Q61080 ChIP-qPCR
Quill ML , et al. 2011
Foxn4 forkhead box N4 116810 Q8K3Q3 ChIP-qPCR
Quill ML , et al. 2011
Frem2 Fras1 related extracellular matrix protein 2 242022 Q6NVD0 ChIP-qPCR
Quill ML , et al. 2011
Fryl furry homolog-like (Drosophila) 72313 F8VQ05 ChIP-qPCR
Quill ML , et al. 2011
Fut7 fucosyltransferase 7 14347 E2D0W5 ChIP-qPCR
Quill ML , et al. 2011
Fxyd6 FXYD domain-containing ion transport regulator 6 59095 Q9D164 ChIP-qPCR
Quill ML , et al. 2011
G6pd2 glucose-6-phosphate dehydrogenase 2 14380 P97324 ChIP-qPCR
Quill ML , et al. 2011
Gab3 growth factor receptor bound protein 2-associated protein 3 210710 Q8BSM5 ChIP-qPCR
Quill ML , et al. 2011
Gabrb3 gamma-aminobutyric acid (GABA) A receptor, subunit beta 3 14402 P63080 ChIP-qPCR
Quill ML , et al. 2011
Gabre gamma-aminobutyric acid (GABA) A receptor, subunit epsilon 14404 A2AMW3 ChIP-qPCR
Quill ML , et al. 2011
Gad2 glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) 14417 P48320 ChIP-qPCR
Quill ML , et al. 2011
Galnt14 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 71685 Q08EC9 ChIP-qPCR
Quill ML , et al. 2011
Galntl6 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6 270049 E5D8G1 ChIP-qPCR
Quill ML , et al. 2011
Gapdhs glyceraldehyde-3-phosphate dehydrogenase, spermatogenic 14447 Q64467 ChIP-qPCR
Quill ML , et al. 2011
Gata3 GATA binding protein 3 14462 P23772 ChIP-qPCR
Quill ML , et al. 2011
Gbp6 guanylate binding protein 7 229900 Q91Z40 ChIP-qPCR
Quill ML , et al. 2011
Gdf1 growth differentiation factor 1 14559 A2RT05 ChIP-qPCR
Quill ML , et al. 2011
Gfi1b growth factor independent 1B 14582 B7ZNH2 ChIP-qPCR
Quill ML , et al. 2011
Ggcx gamma-glutamyl carboxylase 56316 B2RS80 ChIP-qPCR
Quill ML , et al. 2011
Ghdc GH3 domain containing 80860 Q99J23 ChIP-qPCR
Quill ML , et al. 2011
Ghrh growth hormone releasing hormone 14601 P16043 ChIP-qPCR
Quill ML , et al. 2011
Gimap8 GTPase, IMAP family member 8 243374 Q75N62 ChIP-qPCR
Quill ML , et al. 2011
Gjb2 gap junction protein, beta 2 14619 Q00977 ChIP-qPCR
Quill ML , et al. 2011
Gjd4 gap junction protein, delta 4 225152 Q8BSD4 ChIP-qPCR
Quill ML , et al. 2011
Glra3 glycine receptor, alpha 3 subunit 110304 G5E811 ChIP-qPCR
Quill ML , et al. 2011
Glt25d2 glycosyltransferase 25 domain containing 2 269132 Q6NVG7 ChIP-qPCR
Quill ML , et al. 2011
Gm1673 predicted gene 1673 381633 Q3UR78 ChIP-qPCR
Quill ML , et al. 2011
Gm382 predicted gene 382 211208 B1AXN3 ChIP-qPCR
Quill ML , et al. 2011
Gm4793 predicted gene 4793 215714 N/A ChIP-qPCR
Quill ML , et al. 2011
Gm4861 predicted gene 4861 229862 Q8C5A4 ChIP-qPCR
Quill ML , et al. 2011
Gm5094 predicted gene 5094 328839 N/A ChIP-qPCR
Quill ML , et al. 2011
Gm5635 predicted gene 5635 434729 Q3SXD2 ChIP-qPCR
Quill ML , et al. 2011
Gm6377 predicted gene 6377 622976 Q8BHV4 ChIP-qPCR
Quill ML , et al. 2011
Gm711 predicted gene 711 279029 Q80YS9 ChIP-qPCR
Quill ML , et al. 2011
Gm784 fibronectin type III domain containing 3C1 333564 Q6DFV6 ChIP-qPCR
Quill ML , et al. 2011
Gm973 predicted gene 973 381260 E9Q295 ChIP-qPCR
Quill ML , et al. 2011
Gm996 predicted gene 996 381353 A2AJA9 ChIP-qPCR
Quill ML , et al. 2011
Gmds GDP-mannose 4, 6-dehydratase 218138 Q8K0C9 ChIP-qPCR
Quill ML , et al. 2011
Gnai1 guanine nucleotide binding protein (G protein), alpha inhibiting 1 14677 B2RSH2 ChIP-qPCR
Quill ML , et al. 2011
Gnai3 guanine nucleotide binding protein (G protein), alpha inhibiting 3 14679 Q9DC51 ChIP-qPCR
Quill ML , et al. 2011
Gnao1 guanine nucleotide binding protein, alpha O 14681 P18872 ChIP-qPCR
Quill ML , et al. 2011
Gnas GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus 14683 P63094 ChIP-qPCR
Quill ML , et al. 2011
Gnb2 guanine nucleotide binding protein (G protein), beta 2 14693 P62880 ChIP-qPCR
Quill ML , et al. 2011
Gng11 guanine nucleotide binding protein (G protein), gamma 11 66066 P61953 ChIP-qPCR
Quill ML , et al. 2011
Gng13 guanine nucleotide binding protein (G protein), gamma 13 64337 Q9JMF3 ChIP-qPCR
Quill ML , et al. 2011
Gnl2 guanine nucleotide binding protein-like 2 (nucleolar) 230737 Q3V3N5 ChIP-qPCR
Quill ML , et al. 2011
Gnmt glycine N-methyltransferase 14711 A9C489 ChIP-qPCR
Quill ML , et al. 2011
Gpatch2 G patch domain containing 2 67769 Q7TQC7 ChIP-qPCR
Quill ML , et al. 2011
Gpd1 glycerol-3-phosphate dehydrogenase 1 (soluble) 14555 P13707 ChIP-qPCR
Quill ML , et al. 2011
Gpr21 G protein-coupled receptor 21 338346 Q8BX79 ChIP-qPCR
Quill ML , et al. 2011
Gpr26 G protein-coupled receptor 26 233919 Q0VBG4 ChIP-qPCR
Quill ML , et al. 2011
Gpr37 G protein-coupled receptor 37 14763 Q9QY42 ChIP-qPCR
Quill ML , et al. 2011
Gpr50 G-protein-coupled receptor 50 14765 O88495 ChIP-qPCR
Quill ML , et al. 2011
Gpsm1 G-protein signalling modulator 1 (AGS3-like, C. elegans) 67839 Q6IR34 ChIP-qPCR
Quill ML , et al. 2011
Gria1 glutamate receptor, ionotropic, AMPA1 (alpha 1) 14799 P23818 ChIP-qPCR
Quill ML , et al. 2011
Gria3 glutamate receptor, ionotropic, AMPA3 (alpha 3) 53623 Q9Z2W9 ChIP-qPCR
Quill ML , et al. 2011
Grm1 glutamate receptor, metabotropic 1 14816 P97772 ChIP-qPCR
Quill ML , et al. 2011
Gss glutathione synthetase 14854 P51855 ChIP-qPCR
Quill ML , et al. 2011
Gstk1 glutathione S-transferase kappa 1 76263 Q9DCM2 ChIP-qPCR
Quill ML , et al. 2011
Gtf2b general transcription factor IIB 229906 P62915 ChIP-qPCR
Quill ML , et al. 2011
Gtlf3b predicted gene, Gm16515 24083 Q9DBW3 ChIP-qPCR
Quill ML , et al. 2011
Gucy2c guanylate cyclase 2c 14917 Q3UWA6 ChIP-qPCR
Quill ML , et al. 2011
Gvin1 GTPase, very large interferon inducible 1 74558 Q80SU7 ChIP-qPCR
Quill ML , et al. 2011
H2-Q8 histocompatibility 2, Q region locus 8 15019 P79567 ChIP-qPCR
Quill ML , et al. 2011
Hao1 hydroxyacid oxidase 1, liver 15112 Q3UEE8 ChIP-qPCR
Quill ML , et al. 2011
Haus3 HAUS augmin-like complex, subunit 3 231123 Q8QZX2 ChIP-qPCR
Quill ML , et al. 2011
Haus5 HAUS augmin-like complex, subunit 5 71909 Q9D786 ChIP-qPCR
Quill ML , et al. 2011
Hbp1 high mobility group box transcription factor 1 73389 E9Q1A8 ChIP-qPCR
Quill ML , et al. 2011
Hc hemolytic complement 15139 P06684 ChIP-qPCR
Quill ML , et al. 2011
Hcrtr1 hypocretin (orexin) receptor 1 230777 P58307 ChIP-qPCR
Quill ML , et al. 2011
Hdac4 histone deacetylase 4 208727 Q6NZM9 ChIP-qPCR
Quill ML , et al. 2011
Hdgfl1 hepatoma derived growth factor-like 1 15192 Q2VPR5 ChIP-qPCR
Quill ML , et al. 2011
Hepacam2 HEPACAM family member 2 101202 Q4VAH7 ChIP-qPCR
Quill ML , et al. 2011
Heph hephaestin 15203 Q9Z0Z4 ChIP-qPCR
Quill ML , et al. 2011
Hist1h2bc histone cluster 1, H2bc 68024 Q6ZWY9 ChIP-qPCR
Quill ML , et al. 2011
Hist1h4h histone cluster 1, H4h 69386 P62806 ChIP-qPCR
Quill ML , et al. 2011
Hist2h3c1 histone cluster 2, H3c1 15077 P84228 ChIP-qPCR
Quill ML , et al. 2011
Hivep1 human immunodeficiency virus type I enhancer binding protein 1 110521 Q03172 ChIP-qPCR
Quill ML , et al. 2011
Hmcn1 hemicentin 1 545370 D3YXG0 ChIP-qPCR
Quill ML , et al. 2011
Hmgb3 high mobility group box 3 15354 O54879 ChIP-qPCR
Quill ML , et al. 2011
Hmgn3 high mobility group nucleosomal binding domain 3 94353 Q9DCB1 ChIP-qPCR
Quill ML , et al. 2011
Hnrpf heterogeneous nuclear ribonucleoprotein F 98758 Q9Z2X1 ChIP-qPCR
Quill ML , et al. 2011
Hook1 hook homolog 1 (Drosophila) 77963 B1AWM8 ChIP-qPCR
Quill ML , et al. 2011
Hpn hepsin 15451 O35453 ChIP-qPCR
Quill ML , et al. 2011
Hps5 Hermansky-Pudlak syndrome 5 homolog (human) 246694 P59438 ChIP-qPCR
Quill ML , et al. 2011
Hr hairless 15460 Q61645 ChIP-qPCR
Quill ML , et al. 2011
Hs3st1 heparan sulfate (glucosamine) 3-O-sulfotransferase 1 15476 O35310 ChIP-qPCR
Quill ML , et al. 2011
Hs3st3a1 heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1 15478 Q52KJ0 ChIP-qPCR
Quill ML , et al. 2011
Hsf2 heat shock factor 2 15500 P38533 ChIP-qPCR
Quill ML , et al. 2011
Hspa4l heat shock protein 4 like 18415 P48722 ChIP-qPCR
Quill ML , et al. 2011
Hspa5 heat shock protein 5 14828 P20029 ChIP-qPCR
Quill ML , et al. 2011
Hspb3 heat shock protein 3 56534 Q9QZ57 ChIP-qPCR
Quill ML , et al. 2011
Htatip2 HIV-1 tat interactive protein 2, homolog (human) 53415 Q9Z2G9 ChIP-qPCR
Quill ML , et al. 2011
Htr7 5-hydroxytryptamine (serotonin) receptor 7 15566 P32304 ChIP-qPCR
Quill ML , et al. 2011
Hyal1 hyaluronoglucosaminidase 1 15586 Q91ZJ9 ChIP-qPCR
Quill ML , et al. 2011
Id2 inhibitor of DNA binding 2 15902 P41136 ChIP-qPCR
Quill ML , et al. 2011
Ido1 indoleamine 2,3-dioxygenase 1 15930 P28776 ChIP-qPCR
Quill ML , et al. 2011
Ifna1 interferon alpha 1 15962 P01572 ChIP-qPCR
Quill ML , et al. 2011
Ifna9 interferon alpha 9 15972 B1AWY7 ChIP-qPCR
Quill ML , et al. 2011
Ifnb1 interferon beta 1, fibroblast 15977 P01575 ChIP-qPCR
Quill ML , et al. 2011
Ift46 intraflagellar transport 46 76568 Q9DB07 ChIP-qPCR
Quill ML , et al. 2011
Igf1 insulin-like growth factor 1 16000 E9PU89 ChIP-qPCR
Quill ML , et al. 2011
Igsf21 immunoglobulin superfamily, member 21 230868 Q7TNR6 ChIP-qPCR
Quill ML , et al. 2011
Il18rap interleukin 18 receptor accessory protein 16174 Q0VBK3 ChIP-qPCR
Quill ML , et al. 2011
Il1f5 interleukin 1 family, member 5 (delta) 54450 A2AIA9 ChIP-qPCR
Quill ML , et al. 2011
Inpp5k inositol polyphosphate 5-phosphatase K 19062 Q5ND43 ChIP-qPCR
Quill ML , et al. 2011
Ipo13 importin 13 230673 Q8K0C1 GST; IP/WB
Lin W , et al. 2009
Ipo4 importin 4 75751 Q8VI75 GST
Lin W , et al. 2009
Ipo9 importin 9 226432 Q91YE6 GST; IP/WB
Lin W , et al. 2009
Iqub IQ motif and ubiquitin domain containing 214704 Q8CDK3 ChIP-qPCR
Quill ML , et al. 2011
Irs1 insulin receptor substrate 1 16367 P35569 ChIP-qPCR
Quill ML , et al. 2011
Itgav integrin alpha V 16410 P43406 ChIP-qPCR
Quill ML , et al. 2011
Itgb1bp1 integrin beta 1 binding protein 1 16413 O35671 ChIP-qPCR
Quill ML , et al. 2011
Itgb3bp integrin beta 3 binding protein (beta3-endonexin) 67733 B1AZQ7 ChIP-qPCR
Quill ML , et al. 2011
Itm2c integral membrane protein 2C 64294 Q91VK4 ChIP-qPCR
Quill ML , et al. 2011
Iws1 IWS1 homolog (S. cerevisiae) 73473 Q8C1D8 ChIP-qPCR
Quill ML , et al. 2011
Izumo1 izumo sperm-egg fusion 1 73456 Q9D9J7 ChIP-qPCR
Quill ML , et al. 2011
Jph4 junctophilin 4 319984 Q80WT0 ChIP-qPCR
Quill ML , et al. 2011
Kank3 KN motif and ankyrin repeat domains 3 80880 Q9Z1P7 ChIP-qPCR
Quill ML , et al. 2011
Kansl3 KAT8 regulatory NSL complex subunit 3 226976 A2RSY1 ChIP-qPCR
Quill ML , et al. 2011
Kbtbd8 kelch repeat and BTB (POZ) domain containing 8 243574 Q3UQV5 ChIP-qPCR
Quill ML , et al. 2011
Kcna5 potassium voltage-gated channel, shaker-related subfamily, member 5 16493 Q61762 ChIP-qPCR
Quill ML , et al. 2011
Kcnab1 potassium voltage-gated channel, shaker-related subfamily, beta member 1 16497 P63143 ChIP-qPCR
Quill ML , et al. 2011
Kcnab3 potassium voltage-gated channel, shaker-related subfamily, beta member 3 16499 Q8C439 ChIP-qPCR
Quill ML , et al. 2011
Kcne3 potassium voltage-gated channel, Isk-related subfamily, gene 3 57442 Q545H9 ChIP-qPCR
Quill ML , et al. 2011
Kcnj14 potassium inwardly-rectifying channel, subfamily J, member 14 211480 Q8JZN3 ChIP-qPCR
Quill ML , et al. 2011
Kcnt1 potassium channel, subfamily T, member 1 227632 Q6ZPR4 ChIP-qPCR
Quill ML , et al. 2011
Kctd19 potassium channel tetramerisation domain containing 19 279499 Q562E2 ChIP-qPCR
Quill ML , et al. 2011
Kctd4 potassium channel tetramerisation domain containing 4 67516 Q9D7X1 ChIP-qPCR
Quill ML , et al. 2011
Kctd5 potassium channel tetramerisation domain containing 5 69259 Q8VC57 ChIP-qPCR
Quill ML , et al. 2011
Khdrbs2 KH domain containing, RNA binding, signal transduction associated 2 170771 Q9WU01 ChIP-qPCR
Quill ML , et al. 2011
Kif26b kinesin family member 26B 269152 B0G0X9 ChIP-qPCR
Quill ML , et al. 2011
Kirrel3 kin of IRRE like 3 (Drosophila) 67703 Q8BR86 ChIP-qPCR
Quill ML , et al. 2011
Kl klotho 16591 O35082 ChIP-qPCR
Quill ML , et al. 2011
Klf10 Kruppel-like factor 10 21847 O89091 ChIP-qPCR
Quill ML , et al. 2011
Klf13 Kruppel-like factor 13 50794 Q9JJZ6 ChIP-qPCR
Quill ML , et al. 2011
Klf9 Kruppel-like factor 9 16601 Q8CEC4 ChIP-qPCR
Quill ML , et al. 2011
Klhl15 kelch-like 15 (Drosophila) 236904 Q3TEP6 ChIP-qPCR
Quill ML , et al. 2011
Klhl22 kelch-like 22 (Drosophila) 224023 Q99JN2 ChIP-qPCR
Quill ML , et al. 2011
Klk1b11 kallikrein 1-related peptidase b11 16613 P15946 ChIP-qPCR
Quill ML , et al. 2011
Klrc1 killer cell lectin-like receptor subfamily C, member 1 16641 Q9Z202 ChIP-qPCR
Quill ML , et al. 2011
Kpnb1 karyopherin (importin) beta 1 16211 P70168 GST; IP/WB
Lin W , et al. 2009
Krcc1 lysine-rich coiled-coil 1 57896 Q99JT5 ChIP-qPCR
Quill ML , et al. 2011
Krt222 keratin 222 268481 Q8CCX5 ChIP-qPCR
Quill ML , et al. 2011
Krt40 keratin 40 406221 Q6IFX3 ChIP-qPCR
Quill ML , et al. 2011
Krt78 keratin 78 332131 E9Q0F0 ChIP-qPCR
Quill ML , et al. 2011
Krtap6-2 keratin associated protein 6-2 16701 O08884 ChIP-qPCR
Quill ML , et al. 2011
Ksr2 kinase suppressor of ras 2 333050 Q3UVC0 ChIP-qPCR
Quill ML , et al. 2011
L1cam L1 cell adhesion molecule 16728 Q6PGJ3 ChIP-qPCR
Quill ML , et al. 2011
Lamc2 laminin, gamma 2 16782 G5E874 ChIP-qPCR
Quill ML , et al. 2011
Lamtor3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 56692 O88653 ChIP-qPCR
Quill ML , et al. 2011
Lbxcor1 SKI family transcriptional corepressor 1 207667 Q8BX46 ChIP-qPCR
Quill ML , et al. 2011
Lce1e late cornified envelope 1E 68694 Q9D139 ChIP-qPCR
Quill ML , et al. 2011
Lcn12 lipocalin 12 77701 Q2TA58 ChIP-qPCR
Quill ML , et al. 2011
Lenep lens epithelial protein 57275 Q543C4 ChIP-qPCR
Quill ML , et al. 2011
Lgi1 leucine-rich repeat LGI family, member 1 56839 Q9JIA1 ChIP-qPCR
Quill ML , et al. 2011
Lhx5 LIM homeobox protein 5 16873 P61375 ChIP-qPCR
Quill ML , et al. 2011
Lhx6 LIM/homeobox protein Lhx6 16874 Q9R1R0 ChIP
Vogt D , et al. 2014
Limch1 LIM and calponin homology domains 1 77569 Q3UH68 ChIP-qPCR
Quill ML , et al. 2011
Lin7c lin-7 homolog C (C. elegans) 22343 A2ARI2 ChIP-qPCR
Quill ML , et al. 2011
Lingo1 leucine rich repeat and Ig domain containing 1 235402 Q9D1T0 ChIP-qPCR
Quill ML , et al. 2011
Lmnb2 lamin B2 16907 P21619 ChIP-qPCR
Quill ML , et al. 2011
Lmo1 LIM domain only 1 109594 Q924W9 Gene microarray; qRT-PCR; Luciferase reporter assay; ChIP; EMSA
Fulp CT , et al. 2008
Lmo3 LIM domain only 3 109593 Q8BZL8 Gene microarray; qRT-PCR
Colasante G , et al. 2009
Lmo4 LIM domain only 4 16911 P61969 Gene microarray; qRT-PCR
Colasante G , et al. 2009
Lnp limb and neural patterns 69605 A2ASL8 ChIP-qPCR
Quill ML , et al. 2011
Lpar4 lysophosphatidic acid receptor 4 78134 Q8BLG2 ChIP-qPCR
Quill ML , et al. 2011
Lpp LIM domain containing preferred translocation partner in lipoma 210126 Q8BFW7 ChIP-qPCR
Quill ML , et al. 2011
Lrrc18 leucine rich repeat containing 18 67580 Q9CQ07 ChIP-qPCR
Quill ML , et al. 2011
Lrrc26 leucine rich repeat containing 26 227618 Q91W20 ChIP-qPCR
Quill ML , et al. 2011
Lrrc3 leucine rich repeat containing 3 237387 P59034 ChIP-qPCR
Quill ML , et al. 2011
Lrrc49 leucine rich repeat containing 49 102747 G5E8R5 ChIP-qPCR
Quill ML , et al. 2011
Lrrc8a leucine rich repeat containing 8A 241296 Q80WG5 ChIP-qPCR
Quill ML , et al. 2011
Lrrc8d leucine rich repeat containing 8D 231549 Q8BGR2 ChIP-qPCR
Quill ML , et al. 2011
Lrrd1 leucine rich repeats and death domain containing 1 242838 Q8C0R9 ChIP-qPCR
Quill ML , et al. 2011
Lrrtm2 leucine rich repeat transmembrane neuronal 2 107065 Q8BGA3 ChIP-qPCR
Quill ML , et al. 2011
Lsm5 LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) 66373 P62322 ChIP-qPCR
Quill ML , et al. 2011
Maf avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog 17132 P54843 Gene microarray; qRT-PCR
Colasante G , et al. 2009
Mafa v-maf musculoaponeurotic fibrosarcoma oncogene family, protein A (avian) 378435 Q8CF90 ChIP-qPCR
Quill ML , et al. 2011
Mamdc2 MAM domain containing 2 71738 Q8CG85 ChIP-qPCR
Quill ML , et al. 2011
Man1a2 mannosidase, alpha, class 1A, member 2 17156 A2A724 ChIP-qPCR
Quill ML , et al. 2011
Manea mannosidase, endo-alpha 242362 Q6NXH2 ChIP-qPCR
Quill ML , et al. 2011
Mark3 MAP/microtubule affinity-regulating kinase 3 17169 Q03141 ChIP-qPCR
Quill ML , et al. 2011
Mark4 MAP/microtubule affinity-regulating kinase 4 232944 Q8CIP4 ChIP-qPCR
Quill ML , et al. 2011
Mbd3l2 methyl-CpG binding domain protein 3-like 2 234988 Q3UXB0 ChIP-qPCR
Quill ML , et al. 2011
Mbip MAP3K12 binding inhibitory protein 1 217588 Q99LQ1 ChIP-qPCR
Quill ML , et al. 2011
Mboat1 membrane bound O-acyltransferase domain containing 1 218121 Q8BH98 ChIP-qPCR
Quill ML , et al. 2011
Mc2r melanocortin 2 receptor 17200 Q544P9 ChIP-qPCR
Quill ML , et al. 2011
Mcm4 minichromosome maintenance deficient 4 homolog (S. cerevisiae) 17217 P49717 ChIP-qPCR
Quill ML , et al. 2011
Mdfi MyoD family inhibitor 17240 P70331 ChIP-qPCR
Quill ML , et al. 2011
Me3 malic enzyme 3, NADP(+)-dependent, mitochondrial 109264 Q8BMF3 ChIP-qPCR
Quill ML , et al. 2011
Meg3 maternally expressed 3 (non-protein coding) 17263 Q8CCV7 ChIP-qPCR
Quill ML , et al. 2011
Meis1 Meis homeobox 1 17268 Q60954 ChIP-qPCR
Quill ML , et al. 2011
Meis2 Meis homeobox 2 17536 P97367 ChIP-qPCR
Quill ML , et al. 2011
Mep1a meprin 1 alpha 17287 P28825 ChIP-qPCR
Quill ML , et al. 2011
Mesdc2 mesoderm development candidate 2 67943 Q9ERE7 ChIP-qPCR
Quill ML , et al. 2011
Mett10d methyltransferase like 16 67493 Q9CQG2 ChIP-qPCR
Quill ML , et al. 2011
Mett5d1 methyltransferase like 15 76894 Q9DCL4 ChIP-qPCR
Quill ML , et al. 2011
Mex3d mex3 homolog D (C. elegans) 237400 E9PUA0 ChIP-qPCR
Quill ML , et al. 2011
Mfsd12 major facilitator superfamily domain containing 12 73822 Q3U481 ChIP-qPCR
Quill ML , et al. 2011
Mid2 midline 2 23947 B1AVF4 ChIP-qPCR
Quill ML , et al. 2011
Miox myo-inositol oxygenase 56727 Q9QXN5 ChIP-qPCR
Quill ML , et al. 2011
Mlip muscular LMNA-interacting protein 69642 Q5FW52 ChIP-qPCR
Quill ML , et al. 2011
Mllt1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 64144 Q9ERL0 ChIP-qPCR
Quill ML , et al. 2011
Mlxip MLX interacting protein 208104 G5E8D8 ChIP-qPCR
Quill ML , et al. 2011
Mmp9 matrix metallopeptidase 9 17395 P41245 ChIP-qPCR
Quill ML , et al. 2011
Mnat1 menage a trois 1 17420 P51949 ChIP-qPCR
Quill ML , et al. 2011
Mpv17 MpV17 mitochondrial inner membrane protein 17527 P19258 ChIP-qPCR
Quill ML , et al. 2011
Mro maestro 71263 E9PUF9 ChIP-qPCR
Quill ML , et al. 2011
Mrpl27 mitochondrial ribosomal protein L27 94064 Q5SUY2 ChIP-qPCR
Quill ML , et al. 2011
Mrps22 mitochondrial ribosomal protein S22 64655 Q9CXW2 ChIP-qPCR
Quill ML , et al. 2011
Msx2 homeobox, msh-like 2 17702 Q03358 ChIP-qPCR
Quill ML , et al. 2011
Msx3 homeobox, msh-like 3 17703 B2RPS3 ChIP-qPCR
Quill ML , et al. 2011
Mtap1b microtubule-associated protein 1B 17755 P14873 Gene microarray; qRT-PCR
Colasante G , et al. 2009
Mtap4 microtubule-associated protein 4 17758 P27546 ChIP-qPCR
Quill ML , et al. 2011
Mtch2 mitochondrial carrier homolog 2 (C. elegans) 56428 Q791V5 ChIP-qPCR
Quill ML , et al. 2011
Mterfd1 MTERF domain containing 1 66410 Q8R3J4 ChIP-qPCR
Quill ML , et al. 2011
Mtrf1l mitochondrial translational release factor 1-like 108853 Q8BJU9 ChIP-qPCR
Quill ML , et al. 2011
Muc4 mucin 4 140474 E9Q7Q0 ChIP-qPCR
Quill ML , et al. 2011
Musk muscle, skeletal, receptor tyrosine kinase 18198 Q61006 ChIP-qPCR
Quill ML , et al. 2011
Mvd mevalonate (diphospho) decarboxylase 192156 Q3UYC1 ChIP-qPCR
Quill ML , et al. 2011
Mx2 myxovirus (influenza virus) resistance 2 17858 Q9WVP9 ChIP-qPCR
Quill ML , et al. 2011
Mycbp c-myc binding protein 56309 Q8R048 ChIP-qPCR
Quill ML , et al. 2011
Mycbp2 MYC binding protein 2 105689 Q7TPH6 ChIP-qPCR
Quill ML , et al. 2011
Myf5 myogenic factor 5 17877 A2RSK4 ChIP-qPCR
Quill ML , et al. 2011
Myh8 myosin, heavy polypeptide 8, skeletal muscle, perinatal 17885 P13542 ChIP-qPCR
Quill ML , et al. 2011
Myt1 myelin transcription factor 1 17932 B0R0C1 ChIP-qPCR
Quill ML , et al. 2011
Myt1l myelin transcription factor 1-like 17933 P97500 ChIP-qPCR
Quill ML , et al. 2011
N28178 expressed sequence N28178 230085 A2AG27 ChIP-qPCR
Quill ML , et al. 2011
Naa35 N(alpha)-acetyltransferase 35, NatC auxiliary subunit 78689 Q6PHQ8 ChIP-qPCR
Quill ML , et al. 2011
Naalad2 N-acetylated alpha-linked acidic dipeptidase 2 72560 Q9CZR2 ChIP-qPCR
Quill ML , et al. 2011
Nanos2 nanos homolog 2 (Drosophila) 378430 I6ZHM2 ChIP-qPCR
Quill ML , et al. 2011
Napb N-ethylmaleimide sensitive fusion protein attachment protein beta 17957 A2APW8 ChIP-qPCR
Friocourt G and Parnavelas JG 2012
Napepld N-acyl phosphatidylethanolamine phospholipase D 242864 Q8BH82 ChIP-qPCR
Quill ML , et al. 2011
Nde1 nuclear distribution gene E homolog 1 (A nidulans) 67203 Q9CZA6 ChIP-qPCR
Quill ML , et al. 2011
Ndnl2 necdin-like 2 66647 Q9CPR8 ChIP-qPCR
Quill ML , et al. 2011
Ndrg1 N-myc downstream regulated gene 1 17988 Q545R3 ChIP-qPCR
Quill ML , et al. 2011
Neil1 nei endonuclease VIII-like 1 (E. coli) 72774 Q8K4Q6 ChIP-qPCR
Quill ML , et al. 2011
Nenf neuron derived neurotrophic factor 66208 Q9CQ45 ChIP-qPCR
Quill ML , et al. 2011
Neo1 neogenin 18007 Q7TQG5 ChIP-qPCR
Quill ML , et al. 2011
Nfe2l3 nuclear factor, erythroid derived 2, like 3 18025 Q3UZC1 ChIP-qPCR
Quill ML , et al. 2011
Nfib nuclear factor I/B 18028 P97863 ChIP-qPCR
Quill ML , et al. 2011
Nid2 nidogen 2 18074 O88322 ChIP-qPCR
Quill ML , et al. 2011
Nipal4 NIPA-like domain containing 4 214112 Q8BZF2 ChIP-qPCR
Quill ML , et al. 2011
Nkx2-1 NK2 homeobox 1 21869 P50220 ChIP-qPCR
Quill ML , et al. 2011
Nms neuromedin S 433292 Q5H8A1 ChIP-qPCR
Quill ML , et al. 2011
Nox4 NADPH oxidase 4 50490 B2RSM1 ChIP-qPCR
Quill ML , et al. 2011
Nppc natriuretic peptide type C 18159 Q544K5 ChIP-qPCR
Quill ML , et al. 2011
Npy6r neuropeptide Y receptor Y6 18169 Q61212 ChIP-qPCR
Quill ML , et al. 2011
Nr4a1 nuclear receptor subfamily 4, group A, member 1 15370 P12813 ChIP-qPCR
Quill ML , et al. 2011
Nr4a2 nuclear receptor subfamily 4, group A, member 2 18227 Q06219 ChIP-qPCR
Quill ML , et al. 2011
Nrbp2 nuclear receptor binding protein 2 223649 Q91V36 ChIP-qPCR
Quill ML , et al. 2011
Nrl neural retina leucine zipper gene 18185 P54846 ChIP-qPCR
Quill ML , et al. 2011
Nrxn1 neurexin 1 18189 Q9CS84 ChIP-qPCR
Quill ML , et al. 2011
Nt5c1b 5'-nucleotidase, cytosolic IB 70881 Q91YE9 ChIP-qPCR
Quill ML , et al. 2011
Ntng1 netrin G1 80883 Q8R4G0 ChIP-qPCR
Quill ML , et al. 2011
Ntsr2 neurotensin receptor 2 18217 P70310 ChIP-qPCR
Quill ML , et al. 2011
Nub1 negative regulator of ubiquitin-like proteins 1 53312 P54729 ChIP-qPCR
Quill ML , et al. 2011
Nudt16 nudix (nucleoside diphosphate linked moiety X)-type motif 16 75686 Q6P3D0 ChIP-qPCR
Quill ML , et al. 2011
Nxf1 nuclear RNA export factor 1 53319 Q99JX7 ChIP-qPCR
Quill ML , et al. 2011
Nxt2 nuclear transport factor 2-like export factor 2 237082 Q3UNA4 ChIP-qPCR
Quill ML , et al. 2011
Oaz1 ornithine decarboxylase antizyme 1 18245 P54369 ChIP-qPCR
Quill ML , et al. 2011
Ocln occludin 18260 B2RS24 ChIP-qPCR
Quill ML , et al. 2011
Odam odontogenic, ameloblast asssociated 69592 A1E960 ChIP-qPCR
Quill ML , et al. 2011
Odf3l1 outer dense fiber of sperm tails 3-like 1 382075 Q810P2 ChIP-qPCR
Quill ML , et al. 2011
Odz4 odd Oz/ten-m homolog 4 (Drosophila) 23966 Q3UHK6 ChIP-qPCR
Quill ML , et al. 2011
Olfm3 olfactomedin 3 229759 P63056 ChIP-qPCR
Quill ML , et al. 2011
Olfml3 olfactomedin-like 3 99543 Q8BK62 ChIP-qPCR
Quill ML , et al. 2011
Olig3 oligodendrocyte transcription factor 3 94222 Q6PFG8 ChIP-qPCR
Quill ML , et al. 2011
Onecut1 one cut domain, family member 1 15379 O08755 ChIP-qPCR
Quill ML , et al. 2011
Oosp1 oocyte secreted protein 1 170834 Q925U0 ChIP-qPCR
Quill ML , et al. 2011
Orf61 open reading frame 61 216157 Q8CIV2 ChIP-qPCR
Quill ML , et al. 2011
Ormdl3 ORM1-like 3 (S. cerevisiae) 66612 Q9CPZ6 ChIP-qPCR
Quill ML , et al. 2011
Otp orthopedia homolog (Drosophila) 18420 O09113 ChIP-qPCR
Quill ML , et al. 2011
Otx1 orthodenticle homolog 1 (Drosophila) 18423 P80205 ChIP-qPCR
Quill ML , et al. 2011
Ovol1 OVO homolog-like 1 (Drosophila) 18426 Q9WTJ2 ChIP-qPCR
Quill ML , et al. 2011
Oxr1 oxidation resistance 1 170719 Q4KMM3 ChIP-qPCR
Quill ML , et al. 2011
P2rx1 purinergic receptor P2X, ligand-gated ion channel, 1 18436 B2KG89 ChIP-qPCR
Quill ML , et al. 2011
P2rx7 purinergic receptor P2X, ligand-gated ion channel, 7 18439 Q3UN00 ChIP-qPCR
Quill ML , et al. 2011
P2ry10 purinergic receptor P2Y, G-protein coupled 10 78826 Q8BFU7 ChIP-qPCR
Quill ML , et al. 2011
Padi1 peptidyl arginine deiminase, type I 18599 Q544I4 ChIP-qPCR
Quill ML , et al. 2011
Palm2 paralemmin 2 242481 B1AWV1 ChIP-qPCR
Quill ML , et al. 2011
Palmd palmdelphin 114301 Q3UVT7 ChIP-qPCR
Quill ML , et al. 2011
Pank1 pantothenate kinase 1 75735 Q8K4K6 ChIP-qPCR
Quill ML , et al. 2011
Parm1 prostate androgen-regulated mucin-like protein 1 231440 Q923D3 ChIP-qPCR
Quill ML , et al. 2011
Parp12 poly (ADP-ribose) polymerase family, member 12 243771 Q8BZ20 ChIP-qPCR
Quill ML , et al. 2011
Parp8 poly (ADP-ribose) polymerase family, member 8 52552 F8WIK2 ChIP-qPCR
Quill ML , et al. 2011
Patl1 protein associated with topoisomerase II homolog 1 (yeast) 225929 Q3TC46 ChIP-qPCR
Quill ML , et al. 2011
Pax1 paired box gene 1 18503 P09084 ChIP-qPCR
Quill ML , et al. 2011
Pbld phenazine biosynthesis-like protein domain containing 1 68371 Q9DCG6 ChIP-qPCR
Quill ML , et al. 2011
Pcdhac2 protocadherin alpha subfamily C, 2 353237 Q91Y09 ChIP-qPCR
Quill ML , et al. 2011
Pcdhb10 protocadherin beta 10 93881 Q91VE5 ChIP-qPCR
Quill ML , et al. 2011
Pcdhb5 protocadherin beta 5 93876 Q8CEA8 ChIP-qPCR
Quill ML , et al. 2011
Pcdhgc4 protocadherin gamma subfamily C, 4 93707 Q91XX0 ChIP-qPCR
Quill ML , et al. 2011
Pcgf3 polycomb group ring finger 3 69587 Q8BTQ0 ChIP-qPCR
Quill ML , et al. 2011
Pcnxl4 pecanex-like 4 (Drosophila) 67708 E9QN69 ChIP-qPCR
Quill ML , et al. 2011
Pde10a phosphodiesterase 10A 23984 Q8CA95 ChIP-qPCR
Quill ML , et al. 2011
Pde1a phosphodiesterase 1A, calmodulin-dependent 18573 Q9JLL9 ChIP-qPCR
Quill ML , et al. 2011
Pde3a phosphodiesterase 3A, cGMP inhibited 54611 B2RR84 ChIP-qPCR
Quill ML , et al. 2011
Pde6b phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide 18587 P23440 ChIP-qPCR
Quill ML , et al. 2011
Pde8b phosphodiesterase 8B 218461 E9PYP0 ChIP-qPCR
Quill ML , et al. 2011
Pdgfrl platelet-derived growth factor receptor-like 68797 Q6PE55 ChIP-qPCR
Quill ML , et al. 2011
Pdk3 pyruvate dehydrogenase kinase, isoenzyme 3 236900 Q4FJR4 ChIP-qPCR
Quill ML , et al. 2011
Pdlim1 PDZ and LIM domain 1 (elfin) 54132 O70400 ChIP-qPCR
Quill ML , et al. 2011
Pdss1 prenyl (solanesyl) diphosphate synthase, subunit 1 56075 Q33DR2 ChIP-qPCR
Quill ML , et al. 2011
Pdzd9 PDZ domain containing 9 67983 B9EJT5 ChIP-qPCR
Quill ML , et al. 2011
Peg10 paternally expressed 10 170676 Q7TN75 ChIP-qPCR
Quill ML , et al. 2011
Pfn2 profilin 2 18645 Q9JJV2 ChIP-qPCR
Quill ML , et al. 2011
Pgf placental growth factor 18654 P49764 ChIP-qPCR
Quill ML , et al. 2011
Phf19 PHD finger protein 19 74016 Q9CXG9 ChIP-qPCR
Quill ML , et al. 2011
Phkg2 phosphorylase kinase, gamma 2 (testis) 68961 Q9DB30 ChIP-qPCR
Quill ML , et al. 2011
Phlda1 pleckstrin homology-like domain, family A, member 1 21664 Q62392 ChIP-qPCR
Quill ML , et al. 2011
Phox2a paired-like homeobox 2a 11859 Q62066 ChIP-qPCR
Quill ML , et al. 2011
Phtf2 putative homeodomain transcription factor 2 68770 Q8C9D2 ChIP-qPCR
Quill ML , et al. 2011
Phyh phytanoyl-CoA hydroxylase 16922 O35386 ChIP-qPCR
Quill ML , et al. 2011
Pias1 protein inhibitor of activated STAT 1 56469 O88907 ChIP-qPCR
Quill ML , et al. 2011
Pibf1 progesterone immunomodulatory binding factor 1 52023 E9Q6K3 ChIP-qPCR
Quill ML , et al. 2011
Pigr polymeric immunoglobulin receptor 18703 O70570 ChIP-qPCR
Quill ML , et al. 2011
Pik3r3 phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 3 (p55) 18710 Q3UXE9 ChIP-qPCR
Quill ML , et al. 2011
Pitpnb phosphatidylinositol transfer protein, beta 56305 P53811 ChIP-qPCR
Quill ML , et al. 2011
Pkhd1l1 polycystic kidney and hepatic disease 1-like 1 192190 Q80ZA4 ChIP-qPCR
Quill ML , et al. 2011
Pkp4 plakophilin 4 227937 Q68FH0 ChIP-qPCR
Quill ML , et al. 2011
Pla2g15 phospholipase A2, group XV 192654 Q8VEB4 ChIP-qPCR
Quill ML , et al. 2011
Pla2g7 phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) 27226 Q60963 ChIP-qPCR
Quill ML , et al. 2011
Plac1 placental specific protein 1 56096 B1B0W9 ChIP-qPCR
Quill ML , et al. 2011
Plac9 placenta specific 9 211623 Q8K262 ChIP-qPCR
Quill ML , et al. 2011
Plec1 plectin 18810 E9QN87 ChIP-qPCR
Quill ML , et al. 2011
Plekhf1 pleckstrin homology domain containing, family F (with FYVE domain) member 1 72287 Q3TB82 ChIP-qPCR
Quill ML , et al. 2011
Plekhg5 pleckstrin homology domain containing, family G (with RhoGef domain) member 5 269608 B1AS68 ChIP-qPCR
Quill ML , et al. 2011
Plekhg6 pleckstrin homology domain containing, family G (with RhoGef domain) member 6 213522 Q8R0J1 ChIP-qPCR
Quill ML , et al. 2011
Pls3 plastin 3 (T-isoform) 102866 Q3UJG9 ChIP-qPCR
Quill ML , et al. 2011
Plscr2 phospholipid scramblase 2 18828 Q9DCW2 ChIP-qPCR
Quill ML , et al. 2011
Plxnd1 plexin D1 67784 Q3UH93 ChIP-qPCR
Quill ML , et al. 2011
Pmaip1 phorbol-12-myristate-13-acetate-induced protein 1 58801 Q9JM54 ChIP-qPCR
Quill ML , et al. 2011
Pnmt phenylethanolamine-N-methyltransferase 18948 P40935 ChIP-qPCR
Quill ML , et al. 2011
Poc1b POC1 centriolar protein homolog B (Chlamydomonas) 382406 Q8BHD1 ChIP-qPCR
Quill ML , et al. 2011
Pold4 polymerase (DNA-directed), delta 4 69745 Q9CWP8 ChIP-qPCR
Quill ML , et al. 2011
Polk polymerase (DNA directed), kappa 27015 Q9QUG2 ChIP-qPCR
Quill ML , et al. 2011
Polr2j polymerase (RNA) II (DNA directed) polypeptide J 20022 Q3TYI2 ChIP-qPCR
Quill ML , et al. 2011
Polr3e polymerase (RNA) III (DNA directed) polypeptide E 26939 Q9CZT4 ChIP-qPCR
Quill ML , et al. 2011
Por P450 (cytochrome) oxidoreductase 18984 P37040 ChIP-qPCR
Quill ML , et al. 2011
Postn periostin, osteoblast specific factor 50706 Q62009 ChIP-qPCR
Quill ML , et al. 2011
Pot1a protection of telomeres 1A 101185 Q91WC1 ChIP-qPCR
Quill ML , et al. 2011
Pou1f1 POU domain, class 1, transcription factor 1 18736 Q00286 ChIP-qPCR
Quill ML , et al. 2011
Pou4f2 POU domain, class 4, transcription factor 2 18997 Q63934 ChIP-qPCR
Quill ML , et al. 2011
Pou4f3 POU domain, class 4, transcription factor 3 18998 Q63955 ChIP-qPCR
Quill ML , et al. 2011
Ppap2a phosphatidic acid phosphatase type 2A 19012 Q61469 ChIP-qPCR
Quill ML , et al. 2011
Ppap2b phosphatidic acid phosphatase type 2B 67916 B1ASM1 ChIP-qPCR
Quill ML , et al. 2011
Pparg peroxisome proliferator activated receptor gamma 19016 P37238 ChIP-qPCR
Quill ML , et al. 2011
Ppargc1a peroxisome proliferative activated receptor, gamma, coactivator 1 alpha 19017 O70343 ChIP-qPCR
Quill ML , et al. 2011
Ppfibp2 PTPRF interacting protein, binding protein 2 (liprin beta 2) 19024 O35711 ChIP-qPCR
Quill ML , et al. 2011
Ppp1r3a protein phosphatase 1, regulatory (inhibitor) subunit 3A 140491 Q99MR9 ChIP-qPCR
Quill ML , et al. 2011
Ppp2r1a protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform 51792 Q76MZ3 ChIP-qPCR
Quill ML , et al. 2011
Ppp3cc protein phosphatase 3, catalytic subunit, gamma isoform 19057 P48455 ChIP-qPCR
Quill ML , et al. 2011
Pqlc1 PQ loop repeat containing 1 66943 Q80XM9 ChIP-qPCR
Quill ML , et al. 2011
Prc1 protein regulator of cytokinesis 1 233406 G3UW86 ChIP-qPCR
Quill ML , et al. 2011
Prdm8 PR domain containing 8 77630 B2RU90 ChIP-qPCR
Quill ML , et al. 2011
Prkcb1 protein kinase C, beta 18751 P68404 ChIP-qPCR
Quill ML , et al. 2011
Prkd3 protein kinase D3 75292 Q5FWX6 ChIP-qPCR
Quill ML , et al. 2011
Prkrir protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) 72981 Q9CUX1 ChIP-qPCR
Quill ML , et al. 2011
Prl prolactin 19109 Q3TT66 ChIP-qPCR
Quill ML , et al. 2011
Prl5a1 prolactin family 5, subfamily a, member 1 28078 Q9JII2 ChIP-qPCR
Quill ML , et al. 2011
Prl8a6 prolactin family 8, subfamily a, member 6 19112 Q9DAY2 ChIP-qPCR
Quill ML , et al. 2011
Prl8a9 prolactin family8, subfamily a, member 9 67310 Q9CQ58 ChIP-qPCR
Quill ML , et al. 2011
Prmt6 protein arginine N-methyltransferase 6 99890 Q6NZB1 ChIP-qPCR
Quill ML , et al. 2011
Prosapip1 ProSAPiP1 protein 241638 A2AHG0 ChIP-qPCR
Quill ML , et al. 2011
Prpf39 PRP39 pre-mRNA processing factor 39 homolog (yeast) 328110 E9QJV4 ChIP-qPCR
Quill ML , et al. 2011
Prph peripherin 19132 G5E846 ChIP-qPCR
Quill ML , et al. 2011
Prpsap1 phosphoribosyl pyrophosphate synthetase-associated protein 1 67763 B1AT82 ChIP-qPCR
Quill ML , et al. 2011
Prss12 protease, serine, 12 neurotrypsin (motopsin) 19142 O08762 ChIP-qPCR
Quill ML , et al. 2011
Prss58 protease, serine 58 232717 Q8BW11 ChIP-qPCR
Quill ML , et al. 2011
Psd3 pleckstrin and Sec7 domain containing 3 234353 Q2PFD7 ChIP-qPCR
Quill ML , et al. 2011
Psma1 proteasome (prosome, macropain) subunit, alpha type 1 26440 Q3TS44 ChIP-qPCR
Quill ML , et al. 2011
Psmd7 proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 17463 A1L3B8 ChIP-qPCR
Quill ML , et al. 2011
Ptch1 patched homolog 1 19206 Q61115 ChIP-qPCR
Quill ML , et al. 2011
Ptcra pre T cell antigen receptor alpha 19208 P0C6B2 ChIP-qPCR
Quill ML , et al. 2011
Pten phosphatase and tensin homolog 19211 O08586 ChIP-qPCR
Quill ML , et al. 2011
Ptger4 prostaglandin E receptor 4 (subtype EP4) 19219 Q91VE4 ChIP-qPCR
Quill ML , et al. 2011
Ptgr1 prostaglandin reductase 1 67103 A2ALW3 ChIP-qPCR
Quill ML , et al. 2011
Ptpn4 protein tyrosine phosphatase, non-receptor type 4 19258 G5E8E7 ChIP-qPCR
Quill ML , et al. 2011
Pxt1 peroxisomal, testis specific 1 69307 B2KF08 ChIP-qPCR
Quill ML , et al. 2011
Pzp pregnancy zone protein 11287 Q61838 ChIP-qPCR
Quill ML , et al. 2011
Qk quaking 19317 Q9QYS9 ChIP-qPCR
Quill ML , et al. 2011
Rab15 RAB15, member RAS oncogene family 104886 Q3TYB1 ChIP-qPCR
Quill ML , et al. 2011
Rab21 RAB21, member RAS oncogene family 216344 P35282 ChIP-qPCR
Quill ML , et al. 2011
Rab2b RAB2B, member RAS oncogene family 76338 P59279 ChIP-qPCR
Quill ML , et al. 2011
Rab39b RAB39B, member RAS oncogene family 67790 Q0PD14 ChIP-qPCR
Quill ML , et al. 2011
Rab3ip RAB3A interacting protein 216363 Q68EF0 ChIP-qPCR
Quill ML , et al. 2011
Rab43 RAB43, member RAS oncogene family 69834 Q0PD10 ChIP-qPCR
Quill ML , et al. 2011
Rab5a RAB5A, member RAS oncogene family 271457 Q9CQD1 ChIP-qPCR
Quill ML , et al. 2011
Rad23b RAD23b homolog (S. cerevisiae) 19359 P54728 ChIP-qPCR
Quill ML , et al. 2011
Rad54l2 RAD54 like 2 (S. cerevisiae) 81000 E9QKL0 ChIP-qPCR
Quill ML , et al. 2011
Ralb v-ral simian leukemia viral oncogene homolog B (ras related) 64143 Q8CCG5 ChIP-qPCR
Quill ML , et al. 2011
Ranbp10 RAN binding protein 10 74334 Q6VN19 ChIP-qPCR
Quill ML , et al. 2011
Ranbp3 RAN binding protein 3 71810 Q9CT10 ChIP-qPCR
Quill ML , et al. 2011
Rapgef3 Rap guanine nucleotide exchange factor (GEF) 3 223864 Q3UQC2 ChIP-qPCR
Quill ML , et al. 2011
Rapgef5 Rap guanine nucleotide exchange factor (GEF) 5 217944 Q8C0Q9 ChIP-qPCR
Quill ML , et al. 2011
Rasgef1b RasGEF domain family, member 1B 320292 Q8JZL7 ChIP-qPCR
Quill ML , et al. 2011
Rassf5 Ras association (RalGDS/AF-6) domain family member 5 54354 Q5EBH1 ChIP-qPCR
Quill ML , et al. 2011
Rbbp5 retinoblastoma binding protein 5 213464 Q8BX09 ChIP-qPCR
Quill ML , et al. 2011
Rbck1 RanBP-type and C3HC4-type zinc finger containing 1 24105 Q9WUB0 ChIP-qPCR
Quill ML , et al. 2011
Rbm26 RNA binding motif protein 26 74213 E9PUF4 ChIP-qPCR
Quill ML , et al. 2011
Rbm38 RNA binding motif protein 38 56190 Q62176 ChIP-qPCR
Quill ML , et al. 2011
Rbm42 RNA binding motif protein 42 68035 Q91V81 ChIP-qPCR
Quill ML , et al. 2011
Rbm47 RNA binding motif protein 47 245945 Q91WT8 ChIP-qPCR
Quill ML , et al. 2011
Rbms2 RNA binding motif, single stranded interacting protein 2 56516 E9Q7G6 ChIP-qPCR
Quill ML , et al. 2011
Rcl1 RNA terminal phosphate cyclase-like 1 59028 Q9JJT0 ChIP-qPCR
Quill ML , et al. 2011
Rcor1 REST corepressor 1 217864 Q8CFE3 ChIP-qPCR
Quill ML , et al. 2011
Rdh11 retinol dehydrogenase 11 17252 Q9QYF1 ChIP-qPCR
Quill ML , et al. 2011
Reps1 RalBP1 associated Eps domain containing protein 19707 E9Q632 ChIP-qPCR
Quill ML , et al. 2011
Rexo1 REX1, RNA exonuclease 1 homolog (S. cerevisiae) 66932 Q7TT28 ChIP-qPCR
Quill ML , et al. 2011
Rffl ring finger and FYVE like domain containing protein 67338 Q3TEV8 ChIP-qPCR
Quill ML , et al. 2011
Rmi1 RMI1, RecQ mediated genome instability 1, homolog (S. cerevisiae) 74386 Q9D4G9 ChIP-qPCR
Quill ML , et al. 2011
Rnft2 ring finger protein, transmembrane 2 269695 Q3UF64 ChIP-qPCR
Quill ML , et al. 2011
Rpe ribulose-5-phosphate-3-epimerase 66646 B2KGE9 ChIP-qPCR
Quill ML , et al. 2011
Rpl21 ribosomal protein L21 19933 Q9CQM8 ChIP-qPCR
Quill ML , et al. 2011
Rpl29 ribosomal protein L29 19944 P47915 ChIP-qPCR
Quill ML , et al. 2011
Rpn1 ribophorin I 103963 Q5RKP4 ChIP-qPCR
Quill ML , et al. 2011
Rps27l ribosomal protein S27-like 67941 Q6ZWY3 ChIP-qPCR
Quill ML , et al. 2011
Rpusd4 RNA pseudouridylate synthase domain containing 4 71989 Q9CWX4 ChIP-qPCR
Quill ML , et al. 2011
Rraga Ras-related GTP binding A 68441 Q80X95 ChIP-qPCR
Quill ML , et al. 2011
Rragb Ras-related GTP binding B 245670 Q6NTA4 ChIP-qPCR
Quill ML , et al. 2011
Rrp1b ribosomal RNA processing 1 homolog B (S. cerevisiae) 72462 Q91YK2 ChIP-qPCR
Quill ML , et al. 2011
Rspo3 R-spondin 3 homolog (Xenopus laevis) 72780 Q2TJ95 Gene microarray; qRT-PCR
Colasante G , et al. 2009
Rtn4r reticulon 4 receptor 65079 Q99PI8 ChIP-qPCR
Quill ML , et al. 2011
Rtp1 receptor transporter protein 1 239766 B2RSL5 ChIP-qPCR
Quill ML , et al. 2011
Rtp2 receptor transporter protein 2 224055 Q80ZI2 ChIP-qPCR
Quill ML , et al. 2011
Rwdd1 RWD domain containing 1 66521 Q9CQK7 ChIP-qPCR
Quill ML , et al. 2011
S1pr5 sphingosine-1-phosphate receptor 5 94226 Q91X56 ChIP-qPCR
Quill ML , et al. 2011
Saa1 serum amyloid A 1 20208 P05366 ChIP-qPCR
Quill ML , et al. 2011
Sall3 sal-like 3 (Drosophila) 20689 Q62255 ChIP-qPCR
Quill ML , et al. 2011
Samd5 sterile alpha motif domain containing 5 320825 Q3V1H9 ChIP-qPCR
Quill ML , et al. 2011
Sars seryl-aminoacyl-tRNA synthetase 20226 P26638 ChIP-qPCR
Quill ML , et al. 2011
Sbf1 SET binding factor 1 77980 Q6ZPE2 ChIP-qPCR
Quill ML , et al. 2011
Sbk1 SH3-binding kinase 1 104175 Q8QZX0 ChIP-qPCR
Quill ML , et al. 2011
Scfd2 Sec1 family domain containing 2 212986 Q3UPD0 ChIP-qPCR
Quill ML , et al. 2011
Scoc short coiled-coil protein 56367 Q78YZ6 ChIP-qPCR
Quill ML , et al. 2011
Sdc3 syndecan 3 20970 B1ASF5 ChIP-qPCR
Quill ML , et al. 2011
Sdc4 syndecan 4 20971 O35988 ChIP-qPCR
Quill ML , et al. 2011
Sdr39u1 short chain dehydrogenase/reductase family 39U, member 1 654795 Q5M8N4 ChIP-qPCR
Quill ML , et al. 2011
Sdr42e1 short chain dehydrogenase/reductase family 42E, member 1 74032 Q9D665 ChIP-qPCR
Quill ML , et al. 2011
Sec22c SEC22 vesicle trafficking protein homolog C (S. cerevisiae) 215474 Q8BXT9 ChIP-qPCR
Quill ML , et al. 2011
Sema3c sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C 20348 Q62181 ChIP-qPCR
Quill ML , et al. 2011
Sema3g sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G 218877 Q4LFA9 ChIP-qPCR
Quill ML , et al. 2011
Sema6a sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A 20358 O35464 ChIP-qPCR
Quill ML , et al. 2011
Serp1 stress-associated endoplasmic reticulum protein 1 28146 Q9Z1W5 ChIP-qPCR
Quill ML , et al. 2011
Serpina10 serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 217847 Q8R121 ChIP-qPCR
Quill ML , et al. 2011
Serpinb7 serine (or cysteine) peptidase inhibitor, clade B, member 7 116872 Q6P3F8 ChIP-qPCR
Quill ML , et al. 2011
Serpinb9c serine (or cysteine) peptidase inhibitor, clade B, member 9c 20707 I7HJI5 ChIP-qPCR
Quill ML , et al. 2011
Serpini2 serine (or cysteine) peptidase inhibitor, clade I, member 2 67931 Q4G0D3 ChIP-qPCR
Quill ML , et al. 2011
Setd5 SET domain containing 5 72895 Q5XJV7 ChIP-qPCR
Quill ML , et al. 2011
Setd6 SET domain containing 6 66083 Q9CWY3 ChIP-qPCR
Quill ML , et al. 2011
Sf1 splicing factor 1 22668 Q64213 ChIP-qPCR
Quill ML , et al. 2011
Sf3a2 splicing factor 3a, subunit 2 20222 G3UVU2 ChIP-qPCR
Quill ML , et al. 2011
Sfrs1 serine/arginine-rich splicing factor 1 110809 Q6PDM2 ChIP-qPCR
Quill ML , et al. 2011
Sfrs12 splicing regulatory glutamine/lysine-rich protein 1 218543 Q8BZX4 ChIP-qPCR
Quill ML , et al. 2011
Sfrs5 serine/arginine-rich splicing factor 5 20384 O35326 ChIP-qPCR
Quill ML , et al. 2011
Sfrs7 serine/arginine-rich splicing factor 7 225027 Q3THA6 ChIP-qPCR
Quill ML , et al. 2011
Sfxn5 sideroflexin 5 94282 Q925N0 ChIP-qPCR
Quill ML , et al. 2011
Sh3tc2 SH3 domain and tetratricopeptide repeats 2 225608 Q3UPD8 ChIP-qPCR
Quill ML , et al. 2011
Shoc2 soc-2 (suppressor of clear) homolog (C. elegans) 56392 O88520 ChIP-qPCR
Quill ML , et al. 2011
Shox2 short stature homeobox 2 20429 P70390 Gene microarray; qRT-PCR; Luciferase reporter assay; ChIP; EMSA
Fulp CT , et al. 2008
Shroom3 shroom family member 3 27428 Q9QXN0 ChIP-qPCR
Quill ML , et al. 2011
Siah1b seven in absentia 1B 20438 A2AHZ2 ChIP-qPCR
Quill ML , et al. 2011
Siglec5 sialic acid binding Ig-like lectin 5 233186 B7ZN64 ChIP-qPCR
Quill ML , et al. 2011
Sigmar1 sigma non-opioid intracellular receptor 1 18391 O55242 ChIP-qPCR
Quill ML , et al. 2011
Sike1 suppressor of IKBKE 1 66641 Q9CPR7 ChIP-qPCR
Quill ML , et al. 2011
Six6os1 RIKEN cDNA 4930447C04 gene 75801 Q9CTN5 ChIP-qPCR
Quill ML , et al. 2011
Skint10 selection and upkeep of intraepithelial T cells 10 230613 Q8CA07 ChIP-qPCR
Quill ML , et al. 2011
Skint11 selection and upkeep of intraepithelial T cells 11 230623 A7XV14 ChIP-qPCR
Quill ML , et al. 2011
Sla2 Src-like-adaptor 2 77799 A2AVZ2 ChIP-qPCR
Quill ML , et al. 2011
Slc10a5 solute carrier family 10 (sodium/bile acid cotransporter family), member 5 241877 Q5PT54 ChIP-qPCR
Quill ML , et al. 2011
Slc10a7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 76775 Q5PT53 ChIP-qPCR
Quill ML , et al. 2011
Slc12a5 solute carrier family 12, member 5 57138 Q91V14 ChIP-qPCR
Quill ML , et al. 2011
Slc16a10 solute carrier family 16 (monocarboxylic acid transporters), member 10 72472 Q3U9N9 ChIP-qPCR
Quill ML , et al. 2011
Slc16a4 solute carrier family 16 (monocarboxylic acid transporters), member 4 229699 Q8R0M8 ChIP-qPCR
Quill ML , et al. 2011
Slc1a1 solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 20510 P51906 ChIP-qPCR
Quill ML , et al. 2011
Slc22a23 solute carrier family 22, member 23 73102 Q3UHH2 ChIP-qPCR
Quill ML , et al. 2011
Slc25a10 solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10 27376 B1ATZ4 ChIP-qPCR
Quill ML , et al. 2011
Slc26a1 solute carrier family 26 (sulfate transporter), member 1 231583 P58735 ChIP-qPCR
Quill ML , et al. 2011
Slc2a13 solute carrier family 2 (facilitated glucose transporter), member 13 239606 Q3UHK1 ChIP-qPCR
Quill ML , et al. 2011
Slc2a2 solute carrier family 2 (facilitated glucose transporter), member 2 20526 P14246 ChIP-qPCR
Quill ML , et al. 2011
Slc2a3 solute carrier family 2 (facilitated glucose transporter), member 3 20527 P32037 ChIP-qPCR
Quill ML , et al. 2011
Slc2a9 solute carrier family 2 (facilitated glucose transporter), member 9 117591 B9EHN5 ChIP-qPCR
Quill ML , et al. 2011
Slc35d1 solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1 242585 Q8BX24 ChIP-qPCR
Quill ML , et al. 2011
Slc35e1 solute carrier family 35, member E1 270066 Q8CD26 ChIP-qPCR
Quill ML , et al. 2011
Slc43a3 solute carrier family 43, member 3 58207 A2AVZ9 ChIP-qPCR
Quill ML , et al. 2011
Slc46a2 solute carrier family 46, member 2 30936 Q8CA03 ChIP-qPCR
Quill ML , et al. 2011
Slc46a3 solute carrier family 46, member 3 71706 Q9DC26 ChIP-qPCR
Quill ML , et al. 2011
Slc47a1 solute carrier family 47, member 1 67473 Q8K0H1 ChIP-qPCR
Quill ML , et al. 2011
Slc48a1 solute carrier family 48 (heme transporter), member 1 67739 Q9D8M3 ChIP-qPCR
Quill ML , et al. 2011
Slc4a4 solute carrier family 4 (anion exchanger), member 4 54403 O88343 ChIP-qPCR
Quill ML , et al. 2011
Slc52a3 solute carrier protein family 52, member 3 69698 Q9D6X5 ChIP-qPCR
Quill ML , et al. 2011
Slc6a2 solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 20538 O55192 ChIP-qPCR
Quill ML , et al. 2011
Slc6a20 solute carrier family 6 (neurotransmitter transporter), member 20B 22599 O88575 ChIP-qPCR
Quill ML , et al. 2011
Slc6a5 solute carrier family 6 (neurotransmitter transporter, glycine), member 5 104245 Q761V0 ChIP-qPCR
Quill ML , et al. 2011
Slc7a5 solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 20539 Q9Z127 ChIP-qPCR
Quill ML , et al. 2011
Slc8a1 solute carrier family 8 (sodium/calcium exchanger), member 1 20541 P70414 ChIP-qPCR
Quill ML , et al. 2011
Slit2 slit homolog 2 (Drosophila) 20563 Q9R1B9 ChIP-qPCR
Quill ML , et al. 2011
Smad1 MAD homolog 1 (Drosophila) 17125 P70340 ChIP-qPCR
Quill ML , et al. 2011
Smad4 SMAD family member 4 17128 P97471 ChIP-qPCR
Quill ML , et al. 2011
Smarcd2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 83796 Q99JR8 ChIP-qPCR
Quill ML , et al. 2011
Smc6 structural maintenance of chromosomes 6 67241 Q924W5 ChIP-qPCR
Quill ML , et al. 2011
Smu1 smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) 74255 B1AXY3 ChIP-qPCR
Quill ML , et al. 2011
Snapap SNAP-associated protein 20615 Q9Z266 ChIP-qPCR
Quill ML , et al. 2011
Snf1lk salt inducible kinase 1 17691 Q60670 ChIP-qPCR
Quill ML , et al. 2011
Snf8 SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) 27681 Q9CZ28 ChIP-qPCR
Quill ML , et al. 2011
Snrp70 small nuclear ribonucleoprotein 70 (U1) 20637 A2RS68 ChIP-qPCR
Quill ML , et al. 2011
Snrpb small nuclear ribonucleoprotein B 20638 A2APD4 ChIP-qPCR
Quill ML , et al. 2011
Snrpn small nuclear ribonucleoprotein N 20646 P63163 ChIP-qPCR
Quill ML , et al. 2011
Snx15 sorting nexin 15 69024 Q91WE1 ChIP-qPCR
Quill ML , et al. 2011
Snx2 sorting nexin 2 67804 Q9CWK8 ChIP-qPCR
Quill ML , et al. 2011
Snx30 sorting nexin family member 30 209131 Q8CE50 ChIP-qPCR
Quill ML , et al. 2011
Sod1 superoxide dismutase 1, soluble 20655 P08228 ChIP-qPCR
Quill ML , et al. 2011
Sox4 SRY-box containing gene 4 20677 Q06831 ChIP-qPCR
Quill ML , et al. 2011
Sox8 SRY-box containing gene 8 20681 Q04886 ChIP-qPCR
Quill ML , et al. 2011
Spag16 sperm associated antigen 16 66722 Q8K450 ChIP-qPCR
Quill ML , et al. 2011
Spag9 sperm associated antigen 9 70834 Q58A65 ChIP-qPCR
Quill ML , et al. 2011
Spata16 spermatogenesis associated 16 70862 Q8C636 ChIP-qPCR
Quill ML , et al. 2011
Spic Spi-C transcription factor (Spi-1/PU.1 related) 20728 Q6P3D7 ChIP-qPCR
Quill ML , et al. 2011
Spock3 sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3 72902 Q8BKV0 ChIP-qPCR
Quill ML , et al. 2011
Sprr2e small proline-rich protein 2E 20759 O70556 ChIP-qPCR
Quill ML , et al. 2011
Sprr2f small proline-rich protein 2F 20760 O70557 ChIP-qPCR
Quill ML , et al. 2011
Sptssa serine palmitoyltransferase, small subunit A 104725 Q8R207 ChIP-qPCR
Quill ML , et al. 2011
Sptssb serine palmitoyltransferase, small subunit B 66183 Q925E8 ChIP-qPCR
Quill ML , et al. 2011
Spty2d1 SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae) 101685 Q68FG3 ChIP-qPCR
Quill ML , et al. 2011
Srpx sushi-repeat-containing protein 51795 Q9R0M3 ChIP-qPCR
Quill ML , et al. 2011
Srrm3 serine/arginine repetitive matrix 3 58212 Q80WV7 ChIP-qPCR
Quill ML , et al. 2011
Stag3 stromal antigen 3 50878 O70576 ChIP-qPCR
Quill ML , et al. 2011
Stam2 signal transducing adaptor molecule (SH3 domain and ITAM motif) 2 56324 O88811 ChIP-qPCR
Quill ML , et al. 2011
Stk11 serine/threonine kinase 11 20869 Q9WTK7 ChIP-qPCR
Quill ML , et al. 2011
Stmn4 stathmin-like 4 56471 P63042 ChIP-qPCR
Quill ML , et al. 2011
Stox2 storkhead box 2 71069 Q499E5 ChIP-qPCR
Quill ML , et al. 2011
Stx8 syntaxin 8 55943 O88983 ChIP-qPCR
Quill ML , et al. 2011
Sucnr1 succinate receptor 1 84112 Q99MT6 ChIP-qPCR
Quill ML , et al. 2011
Sult2b1 sulfotransferase family, cytosolic, 2B, member 1 54200 O35400 ChIP-qPCR
Quill ML , et al. 2011
Susd4 sushi domain containing 4 96935 Q8BH32 ChIP-qPCR
Quill ML , et al. 2011
Sv2a synaptic vesicle glycoprotein 2 a 64051 Q9JIS5 ChIP-qPCR
Quill ML , et al. 2011
Svs4 seminal vesicle secretory protein 4 20941 P18419 ChIP-qPCR
Quill ML , et al. 2011
Syt15 synaptotagmin XV 319508 Q8C6N3 ChIP-qPCR
Quill ML , et al. 2011
Tacr2 tachykinin receptor 2 21337 P30549 ChIP-qPCR
Quill ML , et al. 2011
Tas2r102 taste receptor, type 2, member 102 387339 F8VPL4 ChIP-qPCR
Quill ML , et al. 2011
Tas2r113 taste receptor, type 2, member 113 387345 Q7M711 ChIP-qPCR
Quill ML , et al. 2011
Tas2r125 taste receptor, type 2, member 125 387352 Q7M710 ChIP-qPCR
Quill ML , et al. 2011
Tas2r129 taste receptor, type 2, member 129 387354 Q7M709 ChIP-qPCR
Quill ML , et al. 2011
Tceal8 transcription elongation factor A (SII)-like 8 66684 Q9CZY2 ChIP-qPCR
Quill ML , et al. 2011
Tcerg1 transcription elongation regulator 1 (CA150) 56070 Q3TH57 ChIP-qPCR
Quill ML , et al. 2011
Tcf1 transcription factor 12 21406 Q3UZ69 ChIP-qPCR
Quill ML , et al. 2011
Tcl1 T cell lymphoma breakpoint 1 21432 P56280 ChIP-qPCR
Quill ML , et al. 2011
Tcp11l2 t-complex 11 (mouse) like 2 216198 Q8K1H7 ChIP-qPCR
Quill ML , et al. 2011
Tekt1 tektin 1 21689 Q5NBU4 ChIP-qPCR
Quill ML , et al. 2011
Tgfb3 transforming growth factor, beta 3 21809 Q91YU7 ChIP-qPCR
Quill ML , et al. 2011
Tgfbi transforming growth factor, beta induced 21810 A1L353 ChIP-qPCR
Quill ML , et al. 2011
Th tyrosine hydroxylase 21823 P24529 ChIP-qPCR
Quill ML , et al. 2011
Thbs4 thrombospondin 4 21828 B2RTL6 ChIP-qPCR
Quill ML , et al. 2011
Themis thymocyte selection associated 210757 Q8BGW0 ChIP-qPCR
Quill ML , et al. 2011
Thnsl2 threonine synthase-like 2 (bacterial) 232078 Q80W22 ChIP-qPCR
Quill ML , et al. 2011
Timm8a1 translocase of inner mitochondrial membrane 8 homolog a1 (yeast) 30058 B1AV37 ChIP-qPCR
Quill ML , et al. 2011
Tiparp TCDD-inducible poly(ADP-ribose) polymerase 99929 Q8C1B2 ChIP-qPCR
Quill ML , et al. 2011
Tle1 transducin-like enhancer of split 1, homolog of Drosophila E(spl) 21885 Q62440 GST; Luciferase reporter assay; IP/WB
McKenzie O , et al. 2007
Tlx2 T cell leukemia, homeobox 2 21909 Q61663 ChIP-qPCR
Quill ML , et al. 2011
Tmc7 transmembrane channel-like gene family 7 209760 Q8C428 ChIP-qPCR
Quill ML , et al. 2011
Tmcc2 transmembrane and coiled-coil domains 2 68875 Q80W04 ChIP-qPCR
Quill ML , et al. 2011
Tmco4 transmembrane and coiled-coil domains 4 77056 Q91WU4 ChIP-qPCR
Quill ML , et al. 2011
Tmed9 transmembrane emp24 protein transport domain containing 9 67511 Q6PDC2 ChIP-qPCR
Quill ML , et al. 2011
Tmeff2 transmembrane protein with EGF-like and two follistatin-like domains 2 56363 Q9QYM9 ChIP-qPCR
Quill ML , et al. 2011
Tmem136 transmembrane protein 136 235300 Q3TYE7 ChIP-qPCR
Quill ML , et al. 2011
Tmem150B transmembrane protein 150B 330460 Q8R218 ChIP-qPCR
Quill ML , et al. 2011
Tmem154 transmembrane protein 154 320782 Q8C4Q9 ChIP-qPCR
Quill ML , et al. 2011
Tmem200a transmembrane protein 200A 77220 B2RUN2 ChIP-qPCR
Quill ML , et al. 2011
Tmem222 transmembrane protein 222 52174 Q8BVA2 ChIP-qPCR
Quill ML , et al. 2011
Tmem232 transmembrane protein 232 381107 Q5K6N0 ChIP-qPCR
Quill ML , et al. 2011
Tmem246 transmembrane protein 246 67063 A2AKL1 ChIP-qPCR
Quill ML , et al. 2011
Tmem35 transmembrane protein 35 67564 B1AV87 ChIP-qPCR
Quill ML , et al. 2011
Tmem65 transmembrane protein 65 74868 Q4VAE3 ChIP-qPCR
Quill ML , et al. 2011
Tmem67 transmembrane protein 67 329795 E9QNI1 ChIP-qPCR
Quill ML , et al. 2011
Tmem90a transmembrane protein 90a 627191 B2RRM8 ChIP-qPCR
Quill ML , et al. 2011
Tmod1 tropomodulin 1 21916 P49813 ChIP-qPCR
Quill ML , et al. 2011
Tnfaip8l2 tumor necrosis factor, alpha-induced protein 8-like 2 69769 Q9D8Y7 ChIP-qPCR
Quill ML , et al. 2011
Tnfrsf19 tumor necrosis factor receptor superfamily, member 19 29820 Q8BUM7 ChIP-qPCR
Quill ML , et al. 2011
Tnfsf18 tumor necrosis factor (ligand) superfamily, member 18 240873 Q7TS55 ChIP-qPCR
Quill ML , et al. 2011
Tnpo2 transportin 2 (importin 3, karyopherin beta 2b) 212999 Q99LG2 ChIP-qPCR
Quill ML , et al. 2011
Tnrc6b trinucleotide repeat containing 6b 213988 Q8BKI2 ChIP-qPCR
Quill ML , et al. 2011
Tob1 transducer of ErbB-2.1 22057 Q640M3 ChIP-qPCR
Quill ML , et al. 2011
Tpbpa trophoblast specific protein alpha 21984 Q9CPR0 ChIP-qPCR
Quill ML , et al. 2011
Tpbpb trophoblast specific protein beta 116913 Q9CQC0 ChIP-qPCR
Quill ML , et al. 2011
Tpd52 tumor protein D52 21985 F8WHQ1 ChIP-qPCR
Quill ML , et al. 2011
Tph1 tryptophan hydroxylase 1 21990 P17532 ChIP-qPCR
Quill ML , et al. 2011
Tpp2 tripeptidyl peptidase II 22019 Q64514 ChIP-qPCR
Quill ML , et al. 2011
Tppp3 tubulin polymerization-promoting protein family member 3 67971 Q9CRB6 ChIP-qPCR
Quill ML , et al. 2011
Trdmt1 tRNA aspartic acid methyltransferase 1 13434 O55055 ChIP-qPCR
Quill ML , et al. 2011
Tril TLR4 interactor with leucine-rich repeats 66873 Q9DBY4 ChIP-qPCR
Quill ML , et al. 2011
Trim21 tripartite motif-containing 21 20821 Q3U7K7 ChIP-qPCR
Quill ML , et al. 2011
Trim40 tripartite motif-containing 40 195359 Q3UWA4 ChIP-qPCR
Quill ML , et al. 2011
Trim44 tripartite motif-containing 44 80985 Q4KMS1 ChIP-qPCR
Quill ML , et al. 2011
Trp53bp1 transformation related protein 53 binding protein 1 27223 P70399 ChIP-qPCR
Quill ML , et al. 2011
Trp53inp2 transformation related protein 53 inducible nuclear protein 2 68728 Q8CFU8 ChIP-qPCR
Quill ML , et al. 2011
Trps1 trichorhinophalangeal syndrome I (human) 83925 G3UW90 ChIP-qPCR
Quill ML , et al. 2011
Tsc22d3 TSC22 domain family, member 3 14605 Q9Z2S7 ChIP-qPCR
Quill ML , et al. 2011
Tspan2 tetraspanin 2 70747 Q9D1X8 ChIP-qPCR
Quill ML , et al. 2011
Tspan3 tetraspanin 3 56434 Q545L1 ChIP-qPCR
Quill ML , et al. 2011
Tspan32 tetraspanin 32 27027 Q9JHH2 ChIP-qPCR
Quill ML , et al. 2011
Tspan4 tetraspanin 4 64540 Q4FJW7 ChIP-qPCR
Quill ML , et al. 2011
Tspan7 tetraspanin 7 21912 Q62283 ChIP-qPCR
Quill ML , et al. 2011
Tspyl1 testis-specific protein, Y-encoded-like 1 22110 O88852 ChIP-qPCR
Quill ML , et al. 2011
Tst thiosulfate sulfurtransferase, mitochondrial 22117 P52196 ChIP-qPCR
Quill ML , et al. 2011
Ttc3 tetratricopeptide repeat domain 3 22129 O88196 ChIP-qPCR
Quill ML , et al. 2011
Ttc32 tetratricopeptide repeat domain 32 75516 Q9DAC7 ChIP-qPCR
Quill ML , et al. 2011
Ttk Ttk protein kinase 22137 Q8BY97 ChIP-qPCR
Quill ML , et al. 2011
Tuba1a tubulin, alpha 1A 22142 P68369 ChIP-qPCR
Quill ML , et al. 2011
Txn1 thioredoxin 1 22166 A2AV97 ChIP-qPCR
Quill ML , et al. 2011
Txndc3 NME/NM23 family member 8 73412 Q715T0 ChIP-qPCR
Quill ML , et al. 2011
Uaca uveal autoantigen with coiled-coil domains and ankyrin repeats 72565 Q8CGB3 ChIP-qPCR
Quill ML , et al. 2011
Ube2i ubiquitin-conjugating enzyme E2I 22196 P63280 ChIP-qPCR
Quill ML , et al. 2011
Ubqln4 ubiquilin 4 94232 Q99NB8 ChIP-qPCR
Quill ML , et al. 2011
Ubr7 ubiquitin protein ligase E3 component n-recognin 7 (putative) 66622 Q52KC0 ChIP-qPCR
Quill ML , et al. 2011
Ubxn4 UBX domain protein 4 67812 Q8C0Z0 ChIP-qPCR
Quill ML , et al. 2011
Ucn urocortin 22226 P81615 ChIP-qPCR
Quill ML , et al. 2011
Ugcg UDP-glucose ceramide glucosyltransferase 22234 O88693 ChIP-qPCR
Quill ML , et al. 2011
Ugt2a2 UDP glucuronosyltransferase 2 family, polypeptide A2 552899 Q6PDD0 ChIP-qPCR
Quill ML , et al. 2011
Ugt2b37 UDP glucuronosyltransferase 2 family, polypeptide B37 112417 Q8VCN3 ChIP-qPCR
Quill ML , et al. 2011
Unc50 unc-50 homolog (C. elegans) 67387 Q9CQ61 ChIP-qPCR
Quill ML , et al. 2011
Unc5d unc-5 homolog D (C. elegans) 210801 Q8K1S2 ChIP-qPCR
Quill ML , et al. 2011
Uncx UNC homeobox 22255 O08934 ChIP-qPCR
Quill ML , et al. 2011
Upp2 uridine phosphorylase 2 76654 Q3UEN1 ChIP-qPCR
Quill ML , et al. 2011
Use1 unconventional SNARE in the ER 1 homolog (S. cerevisiae) 67023 E9Q496 ChIP-qPCR
Quill ML , et al. 2011
Usp3 ubiquitin specific peptidase 3 235441 Q91W36 ChIP-qPCR
Quill ML , et al. 2011
Usp47 ubiquitin specific peptidase 47 74996 Q8BY87 ChIP-qPCR
Quill ML , et al. 2011
Usp53 ubiquitin specific peptidase 53 99526 P15975 ChIP-qPCR
Quill ML , et al. 2011
Usp8 ubiquitin specific peptidase 8 84092 A2AI52 ChIP-qPCR
Quill ML , et al. 2011
Utp6 UTP6, small subunit (SSU) processome component, homolog (yeast) 216987 Q8VCY6 ChIP-qPCR
Quill ML , et al. 2011
V1rc19 vomeronasal 1 receptor 5 171192 B2RQT2 ChIP-qPCR
Quill ML , et al. 2011
V1rc20 vomeronasal 1 receptor 6 171193 Q8R2D4 ChIP-qPCR
Quill ML , et al. 2011
V1rd1 vomeronasal 1 receptor 63 81017 Q9EPT1 ChIP-qPCR
Quill ML , et al. 2011
V1rd15 vomeronasal 1 receptor 183 209824 Q8K3N5 ChIP-qPCR
Quill ML , et al. 2011
V1rd2 vomeronasal 1 receptor 62 81016 Q8R2C0 ChIP-qPCR
Quill ML , et al. 2011
V1rd20 vomeronasal 1 receptor 181 404289 Q0P547 ChIP-qPCR
Quill ML , et al. 2011
V1rf2 vomeronasal 1 receptor 235 171233 Q8R297 ChIP-qPCR
Quill ML , et al. 2011
V1rh13 vomeronasal 1 receptor 219 171272 Q8R271 ChIP-qPCR
Quill ML , et al. 2011
V1rh21 vomeronasal 1 receptor 197 171278 Q8R265 ChIP-qPCR
Quill ML , et al. 2011
V1ri1 vomeronasal 1 receptor 192 252907 Q8K4C9 ChIP-qPCR
Quill ML , et al. 2011
Vars valyl-tRNA synthetase 22321 Q9Z1Q9 ChIP-qPCR
Quill ML , et al. 2011
Vat1 vesicle amine transport protein 1 homolog (T californica) 26949 Q499X4 ChIP-qPCR
Quill ML , et al. 2011
Vnn1 vanin 1 22361 Q9Z0K8 ChIP-qPCR
Quill ML , et al. 2011
Vps4b vacuolar protein sorting 4b (yeast) 20479 P46467 ChIP-qPCR
Quill ML , et al. 2011
Vti1b vesicle transport through interaction with t-SNAREs 1B homolog 53612 Q91XH6 ChIP-qPCR
Quill ML , et al. 2011
Vwa2 von Willebrand factor A domain containing 2 240675 Q70UZ7 ChIP-qPCR
Quill ML , et al. 2011
Wac WW domain containing adaptor with coiled-coil 225131 Q924H7 ChIP-qPCR
Quill ML , et al. 2011
Wasf1 WASP family 1 83767 Q8R5H6 ChIP-qPCR
Quill ML , et al. 2011
Wbscr27 Williams Beuren syndrome chromosome region 27 (human) 79565 Q8BGM4 ChIP-qPCR
Quill ML , et al. 2011
Wdr17 WD repeat domain 17 244484 Q8C8Y2 ChIP-qPCR
Quill ML , et al. 2011
Wdr25 WD repeat domain 25 212198 E9Q349 ChIP-qPCR
Quill ML , et al. 2011
Wfdc1 WAP four-disulfide core domain 1 67866 Q3UQ76 ChIP-qPCR
Quill ML , et al. 2011
Wfs1 Wolfram syndrome 1 homolog (human) 22393 P56695 ChIP-qPCR
Quill ML , et al. 2011
Wrap53 WD repeat containing, antisense to TP53 216853 Q8VC51 ChIP-qPCR
Quill ML , et al. 2011
Xpo7 exportin 7 65246 Q9EPK7 ChIP-qPCR
Quill ML , et al. 2011
Yme1l1 YME1-like 1 (S. cerevisiae) 27377 A2AQY3 ChIP-qPCR
Quill ML , et al. 2011
Zbtb41 zinc finger and BTB domain containing 41 homolog 226470 Q811F1 ChIP-qPCR
Quill ML , et al. 2011
Zbtb7c zinc finger and BTB domain containing 7C 207259 Q8VCZ7 ChIP-qPCR
Quill ML , et al. 2011
Zc3h12d zinc finger CCCH type containing 12D 237256 E9QNR7 ChIP-qPCR
Quill ML , et al. 2011
Zc3hav1l zinc finger CCCH-type, antiviral 1-like 209032 B9EHM1 ChIP-qPCR
Quill ML , et al. 2011
Zdhhc2 zinc finger, DHHC domain containing 2 70546 P59267 ChIP-qPCR
Quill ML , et al. 2011
Zdhhc9 zinc finger, DHHC domain containing 9 208884 B1AVD4 ChIP-qPCR
Quill ML , et al. 2011
Zer1 zer-1 homolog (C. elegans) 227693 Q80ZJ6 ChIP-qPCR
Quill ML , et al. 2011
Zfand6 zinc finger, AN1-type domain 6 65098 Q9DCH6 ChIP-qPCR
Quill ML , et al. 2011
Zfhx4 zinc finger homeodomain 4 80892 Q9JJN2 ChIP-qPCR
Quill ML , et al. 2011
Zfp238 zinc finger protein 238 30928 H7BX69 ChIP-qPCR
Quill ML , et al. 2011
Zfp358 zinc finger protein 358 140482 E9Q8M1 ChIP-qPCR
Quill ML , et al. 2011
Zfp369 zinc finger protein 369 170936 F8VQL6 ChIP-qPCR
Quill ML , et al. 2011
Zfp36l2 zinc finger protein 36, C3H type-like 2 12193 B9EIF6 ChIP-qPCR
Quill ML , et al. 2011
Zfp39 zinc finger protein 39 22698 Q02525 ChIP-qPCR
Quill ML , et al. 2011
Zfp408 zinc finger protein 408 381410 Q3V1D8 ChIP-qPCR
Quill ML , et al. 2011
Zfp516 zinc finger protein 516 329003 Q7TSH3 ChIP-qPCR
Quill ML , et al. 2011
Zfp64 zinc finger protein 64 22722 A2AQR4 ChIP-qPCR
Quill ML , et al. 2011
Zfp688 zinc finger protein 688 69234 E9Q5M9 ChIP-qPCR
Quill ML , et al. 2011
Zfp69 zinc finger protein 69 381549 A2A761 ChIP-qPCR
Quill ML , et al. 2011
Zfp75 zinc finger protein 317 244713 Q0P5V5 ChIP-qPCR
Quill ML , et al. 2011
Zfpm2 zinc finger protein, multitype 2 22762 Q8CCH7 ChIP-qPCR
Quill ML , et al. 2011
Zhx2 zinc fingers and homeoboxes 2 387609 Q8C0C0 ChIP-qPCR
Quill ML , et al. 2011
Zic5 zinc finger protein of the cerebellum 5 65100 Q7TQ40 ChIP-qPCR
Quill ML , et al. 2011
Zim1 zinc finger, imprinted 1 22776 Q6NZC6 ChIP-qPCR
Quill ML , et al. 2011
Zpbp zona pellucida binding protein 53604 B7ZP49 ChIP-qPCR
Quill ML , et al. 2011
Zranb1 zinc finger, RAN-binding domain containing 1 360216 Q7M760 ChIP-qPCR
Quill ML , et al. 2011
Zrsr2 zinc finger (CCCH type), RNA binding motif and serine/arginine rich 2 22184 B1B0E8 ChIP-qPCR
Quill ML , et al. 2011
Zscan30 zinc finger and SCAN domain containing 30 328918 N/A ChIP-qPCR
Quill ML , et al. 2011

HELP
Copyright © 2017 MindSpec, Inc.